Description :
From Genome Similarity Track
Location :
Scaffold_1274:4635- 6199
Sequence
1564 bases(100 bases per row)
CATCACAGAGGTAGGAATACAGACTAACAACAACAATTGTGGCATAtacgtgctgctgggatTCGAATACTTCACCGGAGCATCGACGTTCGGGCGCGTA
GACAGGAAGATACTCCACTACATACGCTACAAGTACTTAATCCTGTGCTACTAAATGAACTCCCTGACAATACATACACTCGTCTTCTTGAGATGGAAAG
CCGCGAGGCTACTTCATGTTCTAGCATACCGACAAGTGTTCAATGGCGATACCCTCCGATGCTACAACATAGGGGAGCATCCAGGTGTGTCGAGTTCGAC
TACTGGGCCTCACAGCGAAGCTTCTATGATCCATGCAGGTCAAGTCGCCATGACTGTTAATCTATGATGATGCTGACAAATTCATGTAACACAAACCATC
ACGCTCAGACCCACCAGTCCTTCCTCTACCTCCTATTATTAGGACACGTATACCCAAGCCCACGCGTGTCCTCAACTCGCTCTATGAGTCTGGAGCGCGT
ATGGTACCACTTGAGATCAGTCGGAGTAGTCTGGACACATTCGGGTACCAGTCTGGAGCAGCCACTTCGTCTCATGTTTCCCAGTCTGGAACGACAACAC
GTGCCTTGCTTAAAAACATAGCGattcggtctttcaaagcaCTACCGATGAGTTTTCATCCGTAAGTACGAGTTTCGGGGCATGATCACCATTTTCCAAA
CCGACTTTCGATTTGTAATCGTTAGAAATTTGTCTACATAAAAACGAGATTTTAACAGTCTTACGTAGTACATTTATGCCATATATATATGCAAGGCACC
ATACATGAACAGTAAATAGCAgactagcgctctgggcgcccgcAACTCGAACGCTTGGGTATGGATAGTCCCAATACAGTAGTCTGACCCGCCCCGCTAC
GCTAAGGCGGCCTTTTTATATGTATATTTTTTACTCACTCACTTGCTAAATCGTTTGCTTTAAGCCCCAATCGAGTGTCTCCTTTAGGTAAGGAAGACCT
CGTTTGGCTGCACGCCAATGCAATAGGCCAGGATTCTCCAGAAATTGACTGTACTCACGAACTAGATACGCTAAGTCCGGACGCGTTTCGAGCATCAAGT
ACATCAAACTTCCGATCACAGATCGGTATGGCTTAGCGTGCATCAGCTCTTTCTCTTCTGTATTCGTCGGGCACATCGTCTTAGTCAACTTCAGATCAGG
CGAACACGGGGTCTTGCACCGATTGCAATCACTCATTCCAAAACGAGATAACACCGACATCGCATACTTGCGTTGACTAATAAACACAGTTCGATCACTG
CGATTACGCGTGATTTCCCAACCGATAATGTAGTGCAGTTCACCAAGAACTTTCATAGTAAAACGAGCTTTCAACATgtccttcaactgctgcataAGTT
TCCTGTTAGGAGCGAACAAAATCAAATCATCCACGTAGATCGGGATGAACACTAGCCAGCCATCAATGACCTTCAGGGCCACACACGGTTCACAGTTTAG
TAATGATAACCCTTGAGCTTCCAAATGGGACTTGAGCAAGCGGAACCACACTCGTGGTGCCTGC