Description :
From Genome Similarity Track
Location :
Scaffold_23:463461- 465970
Sequence
2509 bases(100 bases per row)
CAACGACGACGCCTCCGCCGAGCGTCGGATCTGAACCTCGTTCAGATCGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGACACGGC
CGGTGGAAGTGTGTTATCACATCTTCGATGGCGGGACCGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGAACCGTTGCCAGAGGTTGCCGAGATACT
GAACCTTGAGGAAATGATGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTGGAAAAGGTTGCCGAGATGGTGCTCATAAGACCTGAGACCACTCGGGAGGA
GCTGAACGCCTCCTCTGTTTTTAAACGAGGACGTCCTAAAGGACCTAAACAAGCAGCGTCAGACGCGCTTGGGTTCCGAGATCCTTAATAACCCCAAGGA
TCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGGAGTGAGCAAACACCCACCGACCCAGCTCCCACCAGATCGAGGCGTACGACATGAGATCGATCTC
GTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCA
TGGTGCGGGAGTCGAAGTCCCCGCCCTCGACGCCAAATTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAA
CGCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGTTGTTGAACAACATGGCCGGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGA
TACTACCAGATCCTGATGCGAGAGAGTGACACCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGT
CTAACGCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACATACGTACTTCGACGACATATTCGTCCATAGCCG
TGCCGAAGGAGGCAAGACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTCTACGCCAACATCGCCAAG
TGTGTCTTCGCGTCACCAGAGATTAAGGTTCTCGGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGG
CCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACACGGGCTTCGCTGAGCCCTTGT
CGGGCCTCCTTTAAGAAGGGCGTCGGCTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTGACAGAATCAAGGCCAGTCTCCAAGTGGCCCCTGTCCTGA
CCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGGTTGTGCACTGCTGCAGGCCGACACGGCTGGACATGAACG
CGTCATATCGCTCCAGTCTTGGCAGCTCAAAGCCGCCGAACGGAGCTACCCTGTCCACGACAAGAAGCTTCTGGCAATGAAGTATGGCCTTGTGAAGTTT
CGTGTTCACCTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGGGGA
CGTGGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACATGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCAGACTACGA
GTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGTACGATGAGGCTGTCGCGCCTTTCGTCAAGTTCTTCACG
GCAGGAACGAGCGCGAAGTTCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGGAC
CCAATGAACCTTCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATTCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGTCG
CGAGAAGACGTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCATACATGAAGATATATGAAACATGTCAGCGGGTTT
AACCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGA
CGGACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCTTATTCCGGCCTTCGTCACTGTTACGGGCGAACAAACCGCA
AGGTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGT
TTCCTTTAC