Description :
From Genome Similarity Track
Location :
Scaffold_72:46343- 51266
Transcript NameFunction/comments
Phyca_LT1534575261Protein HIRA

Sequence
4923 bases(100 bases per row)
acccacaggaattctagcttcgttagctgcgcaagtgacgatgggatggctcccacaaagtagttacggtcaagacgcagcgtgcgcagcgcactgagtc
gtgagagtgtatcagggacgtaaccagtcaggaaattggagcttaggtctctgcgtgcaaaaaagactggatccattagctctctgcacttatagtcatt
gatcctagtcgaactcacagctcccgcagcgcgctgagctctttacgaggaaaatctgatggtaagacccccacgaggttattatttggcagacggctgc
tccagcatcaaggtgagctcccaattactgtaccatccagtttcagttgcacttacatggaccggatccggccgtagcgatcgcacacaataccgtacca
ctagaatgcattgaattagtgatgctacaaagagtttgaacagcaaacgcacattgtcgaggcacgggtcgctgtgttcgttctgaatggcccattgccc
cacccagcgctggccctgggtggcccaatacagcagctttagcgcaccacgttcgttccgtgtgatagccacaactgaactcattagcgacagcaacagc
aacaacgaagcgaagacgttccattgcatcgtaaaagctcaactgatcagcttcaacatagcccaacatggctacgaaaataatcccgtacttagtcgaa
ttcctccaataccacatttatatcatttcaaaggtcccaggcattatcccgcgcgcaccgccgagatgctgctggagaagcccgaggacgtcaagcacga
gaattccacgggaacaggtatgtgctgaacttgtaaataagacactcatctatattatgccgctctcgcggactccatattcgcaccggttgctgtgttc
tgacgcgatgaactcggacgatatcacactggtagtatgcgctatctatggtgtggacgcacacccaacgctgcagctgttcgctaccgctggaggagat
aatacagtcaaaatatggtctctgcaggcgccacagggggaaggaatcgccacgtttgagctgctggctacactggcgaatcaccaacaggccgtcaatt
gtgtccgctgggctgggcatggccgttatttggcctcaggctccgatgaccagttggtgctgctctacgagctacaagcaggaactcccgccgctgtccc
ttttggctccaacgctcggcctaataaacagaactgggtacgctgctctacactcgagagacacactatgggtaaggctttggctctctatttggttgct
tttaagataaaggtgctgacactgatacctatggtgcatgatagatgtggcagacgttgcatggtcaccggacgaccgcatgttggcaacctgcagcatt
gacaacaccattctgatctgggatgtgggcgtcggtgcactgagcgaggttatgacgcagccgctacagacactgacaggtcacaatggctgggtaaaag
gtgttgcgtgggaccctgtaggaaaggtgtgggaacgagttgcttaatgagaacgatttgtttcggatctgacgcctacttgcttggtgttatagtatct
atcgagtgccggagaggacaagactgtgcggatgtggaaagttgctgactggcaagaatctgatgtggtgacggagccatttgaaggatgcgcttccaca
tcacacttccgtcgtctctcgtggtctcctgacggttcagtcctctgcgctacccacgctttcagttcgaagaagaatatcgcggctttgctgaaccgtg
gagagtggaccaatgaccttaaatttgtgggtcaccaaggcgttgtgaccagcgcgcggtttaaccccaaattacttggtgcgttgcgtgctgacacaga
cggctactctcttattatgctaatgtttgtgcattgtttgtgccctgcagtgaccaagacagacccggataaggagtttgcatgttgtgcagttggcggt
gaggatgcaactgtaagcatctggctggcacatctagcacgtccgttggcggtcatcaaggattgctttgactcgtcagtcacggacctgacatggtcta
gttctcagtctcttctccttgcttgctcgctcgatggatctatctgttgctttcagtttgccggagacgagattggtacccctatttcggatacgcaaca
aagcaagcttctccaggctaaggtatgcatgcatgcgcctccatacttttacgtaaggtgtacgcattgatgtttcttaattatttgccttgcataaagt
atgggtcccgagccggcataacactcgcatcaacgctggtggagaatcccattcaacttcaggtacgcttaatcttgcgccagttggtgtgggacgaggt
aattgacgaatgtttttatgctttgcagctggaagaaaagtcgacgacctcaccacgtttggccgttaagcggaatactggaaccagtgctgcgccagcc
gtgacgcatacaacaaatacactcgttccgaagaagaagaagaagattggtactcaaaactccagtgttgtacccaacaagccgccaagtggagcaagcc
aaagcgataaaaagcggatttccccagttctgtttcagactgacaccaagtcttcagccagcaacaattcagcttcatcgcgaaacaatattcgcaatat
cctgggcccaactatcgtgtcaccgactgcttcggatgttacactcctagatgctcggatggcatcgacaactgggaaggaggttagtgttgttcctgac
actactaattctgctatgatccagccaaattctgcgccaaacctcagcgaaaagactggagctgtccctaaggagagaccaccctcagcggcgacgaatg
gcacgtcgtctaggccgttaaagccggaggtgaagaaacatggagttgacgggagttcgttgaagagaaaacgagaacctgaacgtgttccaacccaagg
ttctgtagtggtggcgaagtcgagggaagttgtggcacgaccacagaagcgtctgaatgaaaggtttgtcgaatgctgtttaaaagtaaacctcaatgtg
gggaagctacttacttctgtcatacagtagtgctggcgttgccaccggaggtcagttgctgcccgaattttcatttaggctgcagttttctgtagaaatc
gatatgagcgtaccatccagcgttgccattctcaacaccagtggaaggaaaagaagtggatcgatctcttctaaagcagtggtggaagttattgttcata
acctgaagagcccccagccagaagaaattataggtgagactccggcttgcaacgtgtcttttgttccagaactacgtcgctgacattcttggtcacactg
ctgaacagagttaggcccaatttattcgagcgtcaaatgtaccgagggaaacgaggtcaaatggattgaccgaattcctggccgagtcgtgtgcgcagtg
ggaaatgcaagatattgtgctattggtgtacacaacggcgatcttcttgttcttaacaccagcggaagacgtctttttccgtacatcggtacgtaccggt
atatgcatttgccggcttcgctcagaaactgacgttctttgtattgctgttcccagctttgggcaatgctatctcagtaatggagtgcagtgtgggtgag
tcaccctatttgctggtgatcctggttacaggtgatctcaaaatctgggacctggcacagcgcaaacttacgctctcgagctcaatagaggcgattacaa
atgtaagtttggacttcgtaagcctatcttgataggcttgatttctgacttcttgtacgatgtcgtagatcacgccagaagaccatcggaagctgacact
cctccggtgccaggtgacaaccaaggggatgccactgattacgtttgcagagtcaaacgcagaaacgaaagcgaactcgagccttctctcgtacacattc
gactcagggatgtcaacatggtacagaccggcctgatggttgcgagttttacccatttttgctgaattatttatgattctgatttaatgtcatgtaggat
gcgagtggcagacgacagcttcgtgttctcggacttcgcgtctgctctaccgacagacgcagtccgagtcaaaagtgttcctgtacggatttatctcact
cgtgctgactgactgaccacgcaaataattgatcaatgcccatttgtattgcagatcggaccacttcgacggctgcaaaacgcctctggatacggtcgaa
cacagagaggaatcgcttcggcaatgctgttgggtatgtcagacccactgatgcagcgtaacgtgacgcgctcgcaccttgagcaccaggtcgccgctgc
tgttatcctaaaaagctctgctgaatatcgctattggtacgttcaaaccctgtaatgatgtgtactatcttggcgctgacgagtttgatttcgcaggatt
caagcgtacgcgagattcttgacgcatgacgaggatgtgactcgtctggacgagttgtgtgctgaaatgatgggtcccttccacgcgtgcgtacttcctg
gagtttttttatacaagcaatactaagtgctgtgtattctgttacagaccgtcatctccagtcccaagagagaagaagaacggcaatgccgatgagtgtc
gcgagtgggatccgatggtgttggtacgtcggatgtagtttcattagctatggcattatactaacattagatctggagcaggacctcttcaaacgagacg
tgttgaagtcccacatcttgccgacgatcgcagcgaatcgcgcattgcaacgtgtggtgaccaagtatcagctgatgatgagcgagattgaatcatggga
gaacgacgaagaagacgagtctt