Description :
From Genome Similarity Track
Location :
Scaffold_18:463400- 471561
Transcript NameFunction/comments
Phyca_LT1534110647myosinlike protein putative
Phyca_LT1534565546putative sphyngomyelin sunthetase, partial
Phyca_LT1534545576ankyrin repeat-containing protein
Phyca_LT1534533897pyruvate dehydrogenase putative
Phyca_LT1534506245Hypothetical protein

Sequence
8161 bases(100 bases per row)
tgcaggaccttcctggaaaagctacactatgtcctggaccaaggaaccgcgggttacgcgctctcttggttacaagatggctctcactttgtcgttcacc
gctcaaaggaagttgaggtggcaaagcaattggggttgcgagtcttcacgcttcatcaggtgctggagacactgggcttcgagtgccaggaagagagtga
ctggaagtacattatctaccaccacgactgcttcgtgctcggaaaaccagaaaagatcgaggggatactaaaccacgagacgttgtcccccagcaccgct
gttcaggctgtagtgatgcccagtgttgcgtacaactccgagttgaagccgctggaggtccggatgagtcttccggattcgcacccgcagtcctgggagg
ttacaattgcaccgagtgtcctgcctcatttaactttcgacgacacggaggagttgatggttgacgagagcagtacactggcaaacaacactggcgagcg
ttgctggggaagtatgctcgaacacacggacgagtggagtgacaccgacatgaattcaccattgtggtggtctcagcgcagcgatttctctagtatttgc
tcggatgacctgtccgacatcgaaacactctctcagatcagctcgttcttcaactaaaacgtggcaatctgttcgcagcaggataaggatgtcaaagagc
tcaaaggttaaaacatcatggaaggaataacccaaccaaacacaactcgggtaaaaatgcgtactcaggccggaaccaagcagcccttgttgatgtgtat
atgaaatattccatctaccttacacagagttcttgcgctgaaagttagcatcggattccgatcgatcgccactcaagctttcgtcttcagtcatcgccac
ctgcaccgagttcaacggggcagccgttgacggtacgacatcgtgcgtgtccagcgccacagagccatcattagcatcactagagacgtcgactccgtag
aagtcatagatagtcttgacggtgacctccgagtccttgtggttaatgtccttgtggtaggcctcaaacgtcaaccaaaacagcggcacgatgtacagcg
cagagaacacgtcaagtgtgtagtgtttacgcgaagccacaatcaggaacgcgatggcgatctggacacacaccatgatagtgattccgtacttgttggg
ccagaacttccagaccgtaagaatgagagacaccgtgtaaattgtgtgcgagctgaacatcaagtcaccacagccgttgagcgagtctagacgcgtgaac
cactcgctgacggtgggcgggttgaacttcgggttggggatgacgcagggcaccgggtcgttcgggttcgcggctaagcacgtgtcgtcgaactttagct
cacagtgatcagctggggacggcaaggccgtgacgaggaaggagatacagcggaagatcagacagatgctaagctgcatcaagcagcgcttcagcacgat
cacgaggtagcgcggacggccaggctcctgtcggaagagcggaatcgttagaaccagaaggatggcgggaccgaagatggctgcgaagacgagaatatcc
gagagggaagcggcagtgccggtgagctccggcatgagctcatagcctaagtcgtacagcgtgaaccgctgctcagtcgagaggtagtggccctggatgt
agtaggccaggttgtggaagatggcgtggacgtactgcatgatgacgcacggcaagatgatcttccactcctgagccaacagctgcagctcaatcttcac
ataattaatgaagctctccttgtcacggagctgccagcgccttcccattatcgatatagcgttttagtcgatagaactgaacggtagtgattgcttcgct
gatactgtacattttcacagtgagttttacggcttaattccatggagatttcagcatggagacgtacctcagagctttaagctgtgtgctgccggtctgg
ttatcaagtgacgcgtccagggctccaagggacctcctcttccgtgtggaacggcactgaacgtacgcgcttggtctgctgtttggttgtgagaagcgct
ttcctcggccacaaacaggccacaatgacgattgcgcctaactataccgacccccgaaaccgctgacaattaatactatggtatttcgtactccaatcat
gacactcaatgccaaatattatggcttcaataagatctcactattaatatcccgagagtatcgtttttttagagactgtgctgttctgcagggattacgc
actttagtgatcatttggaacgatgttgtcgcagataccgacattgcatcggcttcaaggccttcactttgctcgatgcaacgtgcaggctgcagcaacc
cgacagtctgtcgatatgacagtcttgatgccatgtcactggttgaagacctcaaaatgctctgcgattgaagcgatactaatgataggaaggtgatggc
ggcagtttcgacgctggggtcttccgactggattttcctccgctgcgtgcgactccgacgaatatgaagcgactgggaagttcttcgctccacgacgatg
cggctgggcaagagcaagagcgaggcgcaaaccttcaactcgcgcagcggcaccgcaaaattgtcgctggtagcttcaaaggctgcaaagcgttggagcc
cgaattcgctacacctggcgtgataggaaaactcgcactgagttttacaaccactggaccattgaccaagcacgcgagaatcacttgccaattaccagag
cacgggtggacattacagacaacttcaccgtcaaatgtcgtggtacaattaccgaacccaagagagcatgcggtaaccgctgcactgccgcaggtgaaga
tgaattggagcccttcgaccagaacgatggagtttacactattgaacgacagtgtgatactggctgatactccgctggtgctggttgtgtcgggggttgg
cacaccggagacagcgacgccacagagtgaagctatcgtcacgagtttcgagaaactggtaaataggagcaatgttccagcgtctactcgcggtgggcag
gttattgacggccccactgcttttacgataccgaagattgtaccggggtcaatcggtggagcgaaacgctggaatccgtttaattgttgcccaggagcag
tgtccgatgtgacactagcgtttgctgtcaatgggaagattccttcaggtggaaaaatattgatcgagctgccaccacacggatgggatatggatacaca
gcctgaagtacttctacggacgccggtgtatcataacaaggtgatgactgcgtcatgggactccaatcaacacactctggagatcttcatgggcgccgat
gggacgtctattgatacaaggacgaatgtaattctcacgatttcgaaagtaaaaaatccccaaaaggaaacgatgttcttggctgcttcgaacgacgcat
caacttctgcagctcggctaaccacgttatcggcaagtggcggcgtgatcgacggtcccagtcgaattgaagtggctcgaattagtgaactccgtgaacg
tgatttcgacaaacttatcgaagtacttgacgcagatgcagcagagaacttatcgactgttgaaggcaatatcgctgttgaccgagtgccagaattatta
ctacgagcaggtctcaagttgtctgacgaactgtatcagtcccttgtgattccttgttttccaatacgtcctcctgttcagtccgataatggtgaagctc
taccagcagacaccaccactgtaatatcgcccaccacgccacctgatggttatatatcccgtgaagaactgctgaatgtgtttgcacttgtgtacgctcc
agcttacaaatacggtcaggagctacgcttggcgtgtggtcgaggaaacgtcgatcttgtgcgggaatggattagtcggggctgtaacccgaacgctggg
gatgcttccgggtggtcagcgcttcattatgctgccgactactgtcagctagacgtgatcaatcttctcgtcgaaatgacaactgaaaacgacagcaaca
atgattccaaaacctccacactggatgttaacgctcgcgatggccacggatggaccccacttatgtgtgcagcagccaacggccacgtccccgtaataaa
gaggcttctagcgcttggcgcaggcatctctttgactagctctgaacaccgctctgcactgcattgggcagcaattcgaggaatggctacagcagtatcg
gagctcctcgctgccggagccgacccttgccaagcggatcgttgtggctggactcctttacactgcgcgatgctgcacggcaacaatacctgcacgacca
ttctcatggataaaggtgccgatccagcagcaaaagactcgttagactacatggctcagttctacctcgatgcccaacaagtataagaccacttcaacat
tactgtgattggataaaattcagcaaatcttttctggttaaaatgcttgcgcaaacgcattctgttttccaccaatcacaacgactttgaagtggtagat
gcactccacaagaaaagagctcttgatctctccgcggtctcattccccaagtctcttagccatgcccacgtccgcaggagctaaagttctggccgaggtg
taccgcctgcaccacatcccgctgccgcccatcacgctgcaggcgctgctcaagcgcggaccccatgccagccctgctattgccgcgtcactccaaaatg
atccgcaagctctcaacaaatggcgcgaagtgaatgcacccgctatcgttacatctgctcagttgctgcaccgcgaggctccgatccgcattgcgcgccg
cattgtggacctcgagaacctgccggacgagctaccgcaggccaaacccattgtgtcattgcgtgagcagctgttggagagcttcgaccagctcacgagc
tgcccgctgcctgccaacctcgcgagcgagcgtgagtttgtggagttgcacagaaagatccgcaaggaacatgccacgatgcacggcaatatcgctgagg
ccgtgcaggcgctcgagtacgagccccaaggtctcagtgagtcacttgacaacttctacaactctcgtattggcatccgtatgcttgtggaccaacacat
tgcggcccaaacgccgacccccggtttcactggaattgtaaacgatgagacctcgcccgttaagatcgctcaggacattgtgcacaaggtgcgccctctg
tggcaagacagcctcaacggtgaacagctgccggagatcattgtcaatggggacgaagacgccacctaccgctacgtaccgcagcatatcgagatcatct
tgacggaggtattcaagaacgcggtgctgaacagtctcgcagctgccaagaggacgggagcttcgacacctccacctattaacgtgttgatctctggtgg
aactcatggcgtgtgtgtcaaggtgtcggatctgggcggtggtatgacacgcaaagaggccaatgcactgtcgaactactaccacacggccacatcaccg
gtttccagcggctacgaccccgtcgcggatgtcttggagagacgtgctagtggactggacttttcggattcctttgggttgcgtattgcccagctttacg
ccaaatactttggcggagagctggcgattatgcccatggagggccacggcgtggacacgtatatttacatgaactgcctcactggcgcctcggagctcaa
gtaagttaggtcaattcgctggaggaagaataattcagtgtgcatggtcccttttcattctacatctacatgtcgtgtcgaagttactttattagcaaca
actacaacggtttcctagcacaactactgtagattccatgtacagtcttccatttcggcttcttgttgtggacgaattaaatcttcaagatgccgttcta
ggagaccaatccgactggcatccacccggagtcgtggaggagtccgatggccaacctctctggaagtcgaaagcgtaagtaccgtgatgtttggagcttg
atgccgaaactaaccaattgtctgttgtagtaacgccacatttccacaagagctggggttgatcttgttatcagcccaacctgcagcgattaaatctctt
tctgtgacagttgagattgctagagctccaactcagagtaagtgctgcaaaggaagatttggctagaaaaactaacagttctcactgtttttttagttaa
agttttcgcagcattgccacaacgacatataagagcaagcgcattgcatcaccttgatgctgtatcgtgttatcttagtgctgaatggaagcagtgttgg
tacgtgtacggttgctagacatattagcaggtgaatgctgacattaatcgacagtgatcctatagtatgggaagattcagaagagataagcacatttcga
gaaatggacactagggtcgttcaacttggcgtgtccgagtgttcattcgtcaaacttgttatccaagcaccacgtattggcaacttgtctcgacaggtgc
tgataccggtagttgcaaatgtattttatcactgataccttttgcattgctgcagattttgctggaagacattgaaataataggatcggcagaagatctg
gatccgagtgacgataaacgtatcaatgggcgaatcaatcatcattttccgcaaacataccgacccacactgtttactctcgacaacgactacgatgagt
tacaatcagtgttgctggatgcaggggtgccgatggacctggtagtacaagttgccaatatttctgacagtgcggctggaattccaactccccaacaaca
tagcctagaattgagttctcaaggcaaccatggtgagaattctgacgctactctcatatcgaatgaaagtagcaaccaggaaagcgagaggggccctgtt
tcaccttttgatcgagtattgcggctactcgtagaacaaactactcgcgaaagagctacacttcaggagattcttgccatggagatacatgtaagcgcag
atgaagtgtcttcatggcagtcgcccacgatatcaccgactgatccagtaaacagcaacgagatcgtgctgtacacatttggaatagttcttacgcagtg
cttactctgtggcggagcagacatccaagtgacttgtattcaattggcagagcgtaccgcccctcttttaaaacaagctcttggtgcaacctctgcattt
gagggcttgactgcacttattgttctcggagttcgacaagcaagtacaccccaagttttccagtcagcaattcacttagcatatacagtgttccaggctg
aggtgacacgcgagaagaaggaaccagaatgccaaaatagaggtggaacacatgatgatgtgcagttaagattgatcgacgaagttgcctgtgcgaattg
gagtttcggcctgcgagttatcctagagcggactctcgccagtcctatttgttggtccacgaagtacactgggaaggctacacctcctactgtcaatagg
gaattcctacaatttgttcggttactggtcaaccaagatgaaacacacacgattttcttcaatgagcttcttgatttaattccaaccgacaacgtcgaag
atctaactgttgcaacgaatcgaatgcgactgctacgtctggtgttgcgcaacgatttgattcgctgtcacttaacaacaaacgtgaaaatgtgcatcca
aagattttgcacgaagtttttagacccaccaagcgatactatgacgttgaaaatcggtgaccaaggcaaaatatctcgtttggcgtctgaatgcttagtt
gagcttgaaagacttactctggattctcaaaatctcattcgtaccaatgagttgaccaccgtccacagacacttggaagtcacgaataacccacacaact
atcattcacgttgctattctcacactcccttcttcatccaagatccactatcggacgccgaggtgacggcatttcaagagcagttacagcggtatttctc
tgttgtacctcggccaaaggctctttatcggcattcgtttgtacgagccaaccaagccgat