Description :
From Genome Similarity Track
Location :
Scaffold_1163:4634- 5649
Transcript NameFunction/comments
Phypl_g12620Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1015 bases(100 bases per row)
GTTGCGTCGCGCTCACGCTTCGGCCCGAATCAGCGCGAAGCACAAAGTTGCGAGGACTGTACTGTTATAATTGGTAGTAGAAGActgcgtacatgtagta
gtaGTATTGTACACTGCGAGAATGCATTGCGCGCGACTAGCACGGATCGCGCGCGGCTGGCAAAATGGGCGCTGAAACGCCGGACAGGTTGACAGTGCGT
GTGTGAAATGTGCGTTCAGGTGTTTGGGGATCAACTTTTCGTGCTTATGGAGACAAACGAGCCGCTGCATTGATGCCAATCCAGAGCCCACCGAGCTCCT
TGGGCTCGACTTGATCCCACCATGTGGTACACTGGGCGTCCGTCTTGACTATGGAGCTCAAACTAAAGTAAGGCGTTTTCGAGTCCGAAAGCTGGATTGG
TCGTAGGTGAGTGCGCGCTAGCCAATGGCATGGACCAAAGCAGCTTACACTTGCCACGGCGGTGTGCGGGGTCAAGTTCTAGTCGTCGATGAACGTTTCA
GCCTGTCAACACGACCGCCGATCTCAGGACTGGGCGCTTGTATGTCGGGCAGATAGATGTGCGGGCGATCTCGTCAAGGAAGTCGCTTGTTTCCGCGTTC
AAATCGCGTCAAGAGGCCAACGCTCATTTCCGAATTCGCCTTCGCCTGCCAACGATGTCCAAGGTGCAGTCGCCAGCGCTCACGCCGCAGCTGACGCCGT
CCGTCACGGGCTACGTCAACACCAAGCTCTGGGACGAACGGCCCGTCCGGTATGCCGCTAACGTCCTCAAGCACGTGtgcatcttcctcctcatccTCAC
GGCATGCGAGGAAGTCACGAGCTTCGCCATCGGCCAGTCGCTCAAGAACTTTTTCCAGAAGTTGGGCTGGTCCAACAAGGGCTCCACCTCCATGAAGCTC
ACGTACGACTCCTTCAGCCAGTTCATGTGCATCGTGGCCGGGTACATCGCCGACGAGCGCCTCGGGaagttcaagacgctgctgtcagCCGCCACGCTCG
ACTCCTTcggcctcc