Description :
From Genome Similarity Track
Location :
Scaffold_139:46339- 48667
Transcript NameFunction/comments
Phypl_g4024hypothetical protein

Sequence
2328 bases(100 bases per row)
CATCTGCAAGCTTCGATTTGAGGAATGGTTTCTGGCACATACCGCTCCATGGAGACAGCCAAGAGGTCCTCTCGTTCATGGCGGAGGATGTTTTTTTCCC
GCCACGCCTCAAAGAGCTATGGACTCAGCCCTCCATTTCCAGGGTGCAATGCGTGAGATGCTAGGCGACTTGGTGCCGGAAAATGCAGAAGTGTGGATCG
ACGACATCCTTCTCTTTGCTAACGGTGTGGAGACATATTTCGAGGTACTGCGCGAGTTCTTTGCCCGTCTCGATGCACCGAACTTGAAGCTCAAATTGGG
CAACAGTTCCCTCTTCACGACAGAGGTGGTGTGGTGTGGTCGGGTCATATCCAGAGAAGGTATTCGCCATGATCCAACTCGCGTCGATACTCTCACTGAC
CTGCCACAACCATCAACAGCGGCTGAGCTGCAGTACTTCGTTTGCAACGCGAACTGGCTCCGCGACTCTATCGTCGACATCTCCCGAATATTTGCTCCGT
TGCTGGCCAAGTTGGATGCTACGCGGAAACGTATTGGCAGACGCAGCAAGAACGCACTCAACGTTGCAATTACCTgggtggaggacgaagagaagtGCTA
CGCGGACGCGATTGCAGCAATTCAAGATTCTGCAATGATGGCATTTcctgaagatgaagatcAAGTGTGTGTGTTCATTGATGCCTCCCGGTGTGGGTAC
AGCATAGTTATCACGTCGGTGCGTCAGTGGGATGACGATCTTCCGGTGGAAGAACAAAAGCACCTCCTGGTGGTGTGCAAAGGTGGCCTCTTCAAGGAGT
CACAACTCAACTGGACGATCACTGAAAAGGCGGTCTATCCGATCGGCGTGGCTTGCAGCAACCTGAGCTACATACTTCTTCGTAGGCCTAGATTTCGCCT
GTTGTGCGACCACTCGGACCTTATCGACCTGTTTGCACCTCATGGAGATCTCAAGCAACATGTGCGTGACCGGCTGCAGCGATGAGCGCTAAGGCTGAAC
CGCGTACCGCTACACGATCGAGCACATTGCGGGTGAAAACAAATTGTGAGCTGACATCGTGTCGCGTTGACGTCCACAAGCAGCCATGCATGTACGCGCT
GTCCGCACGCGTAGTAGAACATCAACACCAGCGTCGGACCTCTCCAGAATCCGTCCGCTGTCCGAGGCGGATTCCACTTTCCCGCGATCACCGATGTCAT
GGTAGCTCAGGAAGTAGTCGCTCGGGTCCATGCGGACCGTGCGTTAGTGGAGGAGGAATAATTGCTGGAACGTGATCACAAGCCGTGGGTTCCAACCAGT
CCAGCGGACCTTCTCGCTAGGATCTTCGTTGTCGCCCAAGCGGGGTCCACGGTCACCGAGGCATCGATATGATGGTATCGCTGGTCGCGGACAACTACTT
TGTTGAGAAGGTAGTTGAAAAGACGACGCGATTTGTTCATGCCTGCCTGCTGTGCAAGCACGTAAAAGGTCCAAGACACATTCAACGTCAATATAGGCCA
ACATTCACAGCTACACGACGCAATGAAGCACTGCACTGGGATTTTCTGCACCTGGGACAAGGTTATGGTGACAGTGCCTACCTGTTGTTGCTCAAAGACG
CGCCGAACCACTCCTGCGAGCTTTGCCCTGCGGCAGCCCGACGGCCTATGCGGCTACTGAATCGCTCCTCGATTGGTCGAAACGATTTGGATCCCCGGAT
ATGCTCATCTCGGACCAGGGCACACACTTCTGGAATGAAACAGTCGACCACCTGTGTGCTCGGCTCAAGCTGGATCGTTCGTTCTCTCCGGTGTACACCC
CGTGGGTGAATGACACCATTGAACGCCTGAACAAGGGCGTATTGCAGGTATTAAGAGCTCTGCTTTACGACCTTGGATTTGATCGATTCGAGTGGTCATA
CCTTTTACCACTCTTCCAGGCAGGCCTAAATCATGCCTCCGTGCGGTCGCTCGATGGTCATTCACCGACAGAGATGTTTACAGGGCTCAAACCATCCTCC
CCGCTAGACGTGATCATCCGCCAGACCGATTCCAGAgaggagctggtcgtggctGACTTTGCTGACATATTGCCCCAGATGGAGAAGCTTCGTGTGCCGC
TCGAGGGAATGCACAAATAAGTACTCGATGAAaaggagcgcaagcggcGGTTTGATATAGAGCGGAATCCTGGAGCCGTATGCAACTTCGATGTCGGAGA
CTTCGTTCTATGGTCCCGGATTGATCAGCGCCTGCCAAACAACAAGCTGATCGGCCAGTGGCTTGGTCCGTTTAGagtggtggagaagaaggcccaTGCG
TTCATCATTGAGCATATGACCAGTGGTA