Description :
From Genome Similarity Track
Location :
Scaffold_214:46332- 47669
Transcript NameFunction/comments
g13822.t1hypothetical protein

Sequence
1337 bases(100 bases per row)
GCGCGGGGGGTCCAGCATGCTAGCAAGACCGATGAAGGTCAAGCCAGACTCAATCGCAGCAAAGTTTTCAGTGCGCTCAAGCAGCTTGTGTGCAGGGTGG
TGACGGTCACCGTCGTACGAAGCGAGGTCAGTAAGGTCCTCCTTCTTAGCCAGCGCCAGACAACGAAGCGACTTGCGAGCCAGGCTCGACACCTGAGCGA
GCAGCACCTGGCGACCAGCAGCAGTCAAAGGCTTGACCGTACCATCGCCCAGCTCAACGTGGGTGCATCGGTCAATGAGGCCCTCGGGGGCACCCTTCAC
AAGCAGGATGTTCTGGCTCGAAGTCGACGAGCGGGTGGCGCGCTGCGACGAAGAGGCCCTAGCGCACAGCACCGACATCGACTTGCGGTCACGCGAGAAC
TCGAGCACCGCCAGCTTCTTGTTCTGCTCCTTCAGGTAGTCGTTGCAAAACTGAACCGCCTTCTCGGGGTTGGAAGCGCGCAGCGACTCCAGCTCCGCCT
GCTTCGCACTGTCGAAGGGGAAGCCAATCTTCTCCACGAGCACCTTCAGAGCAGCCTCCGTGGGCTCACCAACACGGACGTACTTGCCATCGTGGCACTC
GATGGCCGACTCGTTACACATCGAGCACACCGTGGCGAGCGAGGACACTGCCTTAAACTGCCCAAGCGGGGCTCCCTGAACCTTGCCGATCGGGGCGTAC
GTGTGTCCCTCGACGTCGTACGTCACCAGCTCCGTATCGGACTTGCCGAGGTGCGAAAACGTAATGCACGACATCTCGTTCGTGGTGAGCGTGCCCGTCT
TATCCGAGCAGATCACCGTGGTGCAGCCGAGCGTCTCCACGGACGGCAGCTTGCGCACAATCGCGTTCTTCTTGGCCATCTTGCGCGTGCCTAGGGCCAG
GCACGTGGTGATGACGGCCGGGAGGCCCTCCGGGATGGCGGCCACGGCCAGAGCCACCGCAATCTTAAAGTAGTAGATGCAGCCCTTGAACACCGAGCCG
TAGATCGGGTCGAAGAAGTTCTTGTAGTTGATGATCCACACGACGATGCAAATGATGGCAATGACCTTGGACAGCAGCTCGCCGAACTCGTCGAGCTTCT
TGGTGAGCGGCGTGTCTTCCTCCTCCTTGGACGCTTCCTGCACCGACTGCTGAATCTTGCCGATCTCCGTCTTCATGCCCACTTGGGTCACCACGCCGTT
GCCCAGGCCGTTCACGACGACCGTGGCAGCGAATAGCATGTTGGTCTTGGCCTGGATGATGTTTTCCGTGCCTTCGGGCAGCGCGTCGATGTCCTTGTTC
ACCGACGTGGACTCGCCCGTCATCTGCGCCTGCTCCA