Description :
From Genome Similarity Track
Location :
Scaffold_13:463244- 465735
Sequence
2491 bases(100 bases per row)
TCGAACTGACGTACCCTATGAGTTATTTATCATTTTAAACAACTATGGTTGTTACTTCCTACGCCCGAACATACCGGTCGAGCAATCTCGCAATCTTATT
CACTTTCCTCAGAACAAGAGACGTGTTGCAAACTTAGCGCAAACGGTCCCACGCGCATTCTTCGTCGACCTGTTATGCTGGTGGAGGTTCTAGAAGAAGG
GGGCGACCTGCAGCGTGATACATCCACGAGACTTGACCGTGTCGTGAGATTTTTTCCTGAAGTTCATAATATCACTGGATGTGTTGATGGATCAGTATGT
CTAGGCTCCCGCGAAGTTCGTCGAGAACAGCATGTTATGTGCTATGCTGGATACTCATCAAAGCGAGCAGGGATAGCCACCGATGCACTACCCCAGCAAG
TCTCCACTGTCCGTTTTGCTAGAAGGGTGTTCCAAGTATATCGAAGAAGATGCTCAAGGACCGATCAATCCCAGCCGCTCTACGTTTCGCGAGGAGCTGA
CTTGACCGTCGAACCAACAGATCTAACCAGTCCGCAGACATAAGGCTCAGAGCTACATTCGCCGGCTCAGTAACTATGGATTCGTTTTGCACAGAAAACG
GAGAGCTTCAACAACAGCTCGCAGTTATCGAACAAGATGTTAAGTGTAGGCGACCGTACAGCAACCAATAAATAACTGTTTATAAGTATTTACTATACCG
ACACGGATTCAGCTCATTCAACTCGATTTTGTTTAGAAAAATTAGTTTCGTACCATCTGCACAAACCGTTAAAAATGACATAAGGTGCGCTGAGTGTCTG
GCCACATTTCCGACGGTGGCGTGTTGTAGAGCAATCCATTTCCGTTGTAAATATTGCGACCAGAGAAATTTCCGTTAATTTTCAGACGTTCACTACTTAG
TGCATCAAGAATTATCCGTAATTTAGGAGAATGAAGCTAACAGAGCCAATATTAGAAAACTGTGTCAAATACTTGCAACAATAACAACGCATTTTTTTAC
CGACGCGTTCTGAGGAGTGCGACGATAACACATATAGGTAATTTTAAAATAGTAATACTTAACACTAAGTAGCTAAGCAGATGTATTTTCACTTCGGCGC
TGGTTTTCCAATAAGTAACGAGATCTACAGTGAAGTTGATGATCTCCGGTCTTCCTTGATGTGCCGCCCGGAATTTTGCTGAGCCCTGGAACGTGATATT
TTTCATTTTACTTCTCCCAGCTTTGAACGGTTCTACACGGGACATCGTGAAAATTTTCGGTAGTGTAGGTTGACATAAACTCAGGGTCACGAAAAGCTTC
TCATCAAAATATGTGTGCGCAATGACTTTGAATTTGAGCTTGTTCGGTATCGGTAACACTGCTTCGGCTTTTGCATCTTCTAATTAGCGGAATACAGAAC
AAAACCACATTACTAGAGCTGCTTCCCCGCCAGAAATATCCCGGACGTCGTTTGGGCATGGGTGGTGGGAGCACCATCACACACGAAGCAACAGTGGGTT
GTTGCGGGTTTCCATCGTGTTGCCTGGAGTTTTAAAGTGCGAGAACATAGTGATCACGCCTTTCGAACTCAAGTGGGCTTCGCTAAACATAATCTGAACA
AATCCTGAGAATGTCAACTTTTTTGTTTGAGAGTCGGGATAGAATAGGATTAGTAGTAGGGCGTATCTTCCGTCGATATCTGAACAATCACGAGACCACG
GTGATTGAAGGCTAAATGCGTGCCGAGCGCTCGTATAACCCAAGTATCTAAAAAATCGAAAATCGAACTCCCTCGTTGTCGGCATGGATAACTTGTTCAT
CTACCCAAGCGATGTCTCGGTCTTCGGTCTGTGAACCATTCCAACGACGCCGTTGATGTACCCATGACTGGGAAACAGGGCCGCCTAGTGGGTGTTATAA
CGTGGTTAAAAGGCTTGCTGGGGCGTTGAGAACAGGCAAACGACGCTGACAGGGTATAAGCAGCACTATGACATCGAAGGATTTGCCGGAAGTGGGACTT
AGGTAACGGAACTAGGGTGGTGAGTTACGGAAGCTAAGCTAGTGCTGTGAATACGACCAGTGGGTGTAGTAGTTACGTCCTATTTTTCGTTACTGAACAC
TTTATTGCCTTTATGTTTCGTCGTTTATGATTATAGTAAACATTTTATCTATAGTCTTTAAATACGGTGCGGCAAAATCCGACCGGCTATTGTCTACGAT
AAATAGATAAACTATTCATATCAAAACATACCTAACGGTGCACAACAAATACCAAATTTCGTGTAAGTTATATGGAAAACTATGCACACCTTTATGAAAA
AAACTGATTATTTTATTCAAGTCGTGCGACGTAAATTGTTCTTTTGTTAATTGCATTACAGAAATAAatttcggtaaatagggttagtttagggttatag
gttctacttcgacacattcgaacacatatttgtcggaatccacttgtattaatgtgtatctacgaacgccaagtttgtaacacatttagta