Description :
From Genome Similarity Track
Location :
contig_24:463236- 464677
Transcript NameFunction/comments
g5729.t1hypothetical protein

Sequence
1441 bases(100 bases per row)
GCAAGGTTAAATGTCCACCCTTTAACGATCGCGGCACCCAGAGTACTAATGATCCTCCGCCGGATCCTGGAATGCCAATAATATTTGGGCGCCATCGATC
CAAATACATCGTCTTGTCTTGGAGCTCAGCAAGTGTGGCATTCCATGTCGTGGTCTTGCATGAGTTGACTTTGACTTCCGCATAGTTGCTGCCACCCGAA
TGAATGACGACTGTCACGTCTTTAGTGTCTGTGCTCTTGAAGATGATGTTCACCATACCGTCGCCTTCCCTCGTCCAAGACCCATAGCTGCCTTCAAACG
CCTCGTCCACAGTTGTAAGTCCTAGAGCGTCGAAGAGCGTACCGTCGTCAATTTCTCCGATAAAGGACGTTGGTCCGCAGGTTGGCTGAACAAACTGCGA
CATCATCCAAATAATTCCCATCGGATCGAGACCAGCTAGTACAACGAGTCCCAGGTTCGATGCTTCGAGCGTGGAGTCATCCTTTGCAACCGAGGCTCCC
ATATCTGTATCGTTAGATAAGATCAGCTGGTCGATGATAACACCCATCGTCTTGCGAAGCAAATCACGGGTCTGGAAGGCAGCTTCAGTGGTCTTGTTGC
CCAGAATCTCGCCCATGCAGTTGTTTGTGACGACTGGGGCGTCGCATAGCACCAGTGACGACCTGCTAATTGTCACTCGAATATCATCTGTAGTGGCGCT
GGGCGTTGCGTTGCGAATGCTGTTGACTGCATTACTGACGCGATCCGTGAGACTTTTAAGCTGGTATCCGCAGGTCGTGTTGGAGTCCAAAAAGTCCTGC
AGTTTGACCAACGTCGAATCATCCTCCGAGTTGAGCGCGCTCACATTGGTAAGAAAAGTCATCACATCGGTTGCGGACGATAAAATCTGATCACCGTTGA
TGATAGCCTGCTTCACAATATTCTCCACAACCGTGACCACAACACCAGCTACTCTTGTTGCGAACGAAACAGGGTACCCGAGACAGGTGCAGACCGCGAC
AGGCAAGTCCACGAGGACAACATCAGCCTGGTACGCTATCGCAAGTAATTCTTCGACAGAACCTTGAGGAGCCGTAGTCTGCTGGAATCGGAGGTAGTAG
ATGAGGGATTTGAGCACGCCGATGATGCTAGCAGCACACATGTATGTCTGTTGTGTAAGCTTGTACGCGGCACCGACTTCACCAAATAGACCAGCAGTTG
CTGTATTGACCATGACAGCCACCACCGACGCCGTCTTTTGAAGAATCTCCAATGCACAGTCATCGTTTTGCGGGATGCACTCCAAAAAACATTTAACTGG
GTATGATAACGGACACTGTGCGATGCAGTTGGTGTCAGTCTTGTTGTAACCGAGCGGGCACACGCCATTGCTACTAATGGCCTCCGTCTTCCTGTAGCAT
GCCGAGTCCTTTGCATCGCCGATAGTTGGTCCTACCCAGTT