Description :
From Genome Similarity Track
Location :
contig_24:463221- 464685
Transcript NameFunction/comments
g5445.t1hypothetical protein

Sequence
1464 bases(100 bases per row)
TTAGCTCGCATTGATTCGGACGTGCAAGGTTAAATGTCCACCCTTTAACGATCGCGGCACCCAGAGTACTAATGATCCTCCGCCGGATCCTGGAATGCCA
ATAATATTTGGGCGCCATCGATCCAAATACATCGTCTTGTCTTGGAGCTCAGCAAGTGTGGCATTCCAGGTCGTGGTCTTGCATGAGTTGACTTTGACTT
CCGCATAGTTGCTGCCACCCGAATGAATGACGACTGTCACGTCTTTAGTGTCTGTGCTCTTGAAGATGATGTTCACCATACCGTCGCCTTCCCTCGTCCA
AGACCCATAGCTGCCTTCAAACGCCTCGTCCACAGTTGTAAGTCCTAGAGCGTCGAAGAGCGTACCGTCGTCAATTTCTCCGATAAAGGACGTTGGTCCG
CAGGTTGGCTGAACAAACTGCGACATCATCCAAATAATTCCCATCGGATCGAGACCAGCTAGTACAACGAGTCCCAGGTTCGATGCTTCGAGCGTGGAGT
CATCCTTTGCAACCGAGGCTCCCATATCTGTATCGTTAGATAAGATCAGCTGGTCGATGATAACACCCATCGTCTTGCGAAGCAAGTCACGGGTCTGGAA
GGCAGCTTCAGTGGTCTTGTTGCCCAGAATCTCGCCCATGCAGTTGTTTGTGACGACTGGGGCGTCGCATAGCACCAGTGACGACCTGCTAATTGTCACT
CGAATATCATCTGTAGTGGCGCTGGGCGTTGCGTTGCGAATGCTGTTGACTGCATTACTGACGCGATCTGTGAGACTTTTAAGCTGGTATCCGCAGGTCG
TGTTGGAGTCCAAAAAGTCCTGTAGTTTGACCAACGTCGAATCATCCTCCGAGTTGAGCGCGCTCACATTGGTAAGAAAAGTCATCACATCGGTCGCGGA
CGATAAAATCTGATCGCCGTTGATGATAGCCTGCTTCACAATATTCTCCACAACCGTGACCACAACACCAGCTACTCTTGTTGCGAACGAAACAGGATAC
CCGAGACAGGTGCAGACCGCGACAGGCAAGTCCACGAGGACAACATCAGCCTGGTACGCTATCGCAAGTAATTCTTCGACAGAACCTTGAGGAGCCGTAG
TTTGCTGGAATCGAAGGTAGTAGATGAGGGATTTGAGCACTCCGATGATGCTAGCAGCACACATGTATGTCTTTTGTGTAAGTTTGTACGCGGCACTGAC
TTCACCAAATAGACCAGCAGTTGCTGTATTGACCATGACAGCCACCACCGACGCCGTCTTTTGAAGAATCTCCAATGCACAGTCATCGTTTTGCGGGATG
CACTCCAAAAAACATTTAACTGGGTATGATAACGGACACTGTGCGATGCAGTTGGTGTCAGTCTTGTTGTAACCGAGCGGGCACACGCCATTGCTACTAA
TGGCCTCCGTCTTCCTGTAGCATGCCGAGTCCTTTGCATCGCCGATAGTTGGTCCTACCCAGTT