Description :
From Genome Similarity Track
Location :
Scaffold_1478:4631- 6189
Transcript NameFunction/comments
Phypl_g13514transposase

Sequence
1558 bases(100 bases per row)
TACACCATTTCCCGACCAAGTCGGCATTTTTACCAAAGGAAGTGAACAAACACCTTTTTTGGTCAAAATCAGTCGAGTATAAAAAGTCGTTTCCCAGAAA
GTGAAAATTTGATTAGTCGAGCTCTCAATCAAGTGAACATGGCTACAACCCTCAACTTGCTAGCTACTTGCCTAGCTCCATGTCTTCACCCCTGCCCGCT
GCAAAGGACGCCTTGAGGCAATGGCGCTCCATGCATCACACAAGACGACGAGTAATTGCCGGCTTAGCGATCTCAACAGCCTCCTCCATGAGAGCTCGGC
GGTGCGCGCAGAACGTCTCGTACTCGCCCCTCACTAAGAACGCCTCTTTGCGCTCGGCCGTGAAGCGGCgcatcttcgccttcagcacgTTCCAGCATCC
CTCGATTGGGTTTAGCATGGGGCTGTAGGGGGCGAGCCGCAGCACAACTAGCTTGATGGCGATCACGATGCCGTCCGTCGCGAGCATCTCCCTTACTAGC
ATCTCCACTTCACTATGAGCTGGCGCATTGTCGGTCACGATGACAATCTTGTTCGTCGGCGCCAGCTCACAGTACTCTTCCGTCCCAAGCGCAGCTGTGA
AGATGTCGGCGACGAAGCGGGCATTCTCGTGCTTCTTTACGGAGCCGGCGTGCATACGCATAAGCACGGTGCCAGTACCCGAAGACACGCCGCCCAATAC
GTGCAGGTTGGAGCCCTGCGAAGGGGTGAGTGCCACAGTGGCGCGCTCGCCGACGCGTGAGTAGCCCTCGCTGCGGGATAGATACATATTAAAGTTGGTC
TCGTCGTGGAATACGATCATGTCGCCACGCGACGCGTGTTTCTCCAACTTTTCCACAAACGCCTTCCTCTTGTTCTTGTTCTCCGTTTTGTTCATAGTCA
CCTTCTCGATTCGTAGCTTCTTGAGACTGTACACCATTCCCTGCAGCGATTGGTGAACAGACGACGTGCTCACGGACACGCCCAAGTCGCTGCGCAGCCT
GTCGCACATTTGCTTGCAGGTGTGGTGGCAATCCTCGTCGAggtactgctccagcttgcccATGACCTCCATGGTCATCTTGACGCGCGCGCCCCGCACA
CCACCGTGTGTCTTGGGCTCGCCGTCGGCGTTGAGGACAGCGCGGCGAGCCGTGCTATAGGGAACGTCGTTGTGCGTGGCGACTTCGCGCCAGTTCGCGC
CTTCCTTGAACGCACGCACGACGCGAGCCTTGGCTGCTgtgcgctcgtgctggcgttgcttGTTGATTGACTGGAGGGGGCGGGGGGTGGAGGGCATCGT
GCTGGGGGAAGAGGCCAAATTGAAGTGAGTGCGCCTTTGCGTGGCGGCGCCGGATGGAATGACTGGCGCAGGAGATTGCTGTTTTGGCGCCAATACGATT
GGTTGTCTTCGCTTGATTGGGAACGCGATGGCGCGAAAGTTCACTTTGTGCGAAATGTCACATTTTTATCAAAAAATCCCGGTTAGATTTTCACCACGAA
TTTCTCTCTGTTCACTTGCTTTGGTAAAAATGCCGACTTGGTCGGGAAATGGTGTAGT