Description :
From Genome Similarity Track
Location :
Scaffold_15:463084- 464876
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05316Hypothetical protein
Sappa_CBS223.65SPRG_053173-demethylubiquinone-9 3-methyltransferase, putative

Sequence
1792 bases(100 bases per row)
TTCAGATTGGCTCGTTCCTCTCAAAAGCAATACTGCATATCTCCAAAACCTGTGCACTGAATCTCAACAATGGACGGTCGACCGTCCGCATCGTCCGAGG
CAACGTCGTTCTTGACGCCGACGCCCAAGGAGCTCACGCGAGCCTACATCCTCACCAGCAACAAGGGCAAGTTTGCCTGCTCCGACGACGTTGCAATGCT
CCGTCATGTCCTGCGCTGGTGTCCGTGGGAAGCCGCGCATGGCAGCGTCATGGCGACGTGGGACCGCGTGGCCGAGGACGTTGCCCAGTCGCCCGACTTC
AAGCTCAAAGGCAAGACGGGCGCCGCGCTCAAGTCGCGCTTTGAGACGCTTCTCGTCAAGTTTTGCGCCAACGACATGCAGCGACTGCGCAAGCTGGGCA
CGCCCGCTGAGTTCGCCGAGCGCGAGGTCCTTTTGACAGATATCCGACTCCAAATGCAGGGACCATCCGAGGCCGACGAGACTCGGGCAGAAGATGAAGA
CGAGGACGAAGACGAGAACGCGGGTTTGATTGAGCTGGCCACAGCGTCTGGTGGCACAGTACGGGCCATCGAGGTCTCGTCACTCTACGACGATGAACCA
TCGACGGCGAACGAGCCAAGGGCGGTCGACGGGCCGTCATCCGCTATTCATGAGGCTGCGGTACAACGACCCAGCACACTCGAGCCATGTACGCCAGACC
AAGACAATGGCTCGAGTTCTCGATCATCTGCCGAGTGCCCCCTGAAGCGCAAGGCGGCGACGCTCGATGCCGAGGAAAATTCTCTCAATGCGTCGCTTGT
ACGCACGCTGTGTGAAAACCGCACCCGGGACGCGGCTTGCGCAGAGGCGACGCTTGCTCTGGCGCGGGATCGTCTGGCATTTGATCGCGACCAAGCACGA
CAGCGGCTCGAGATCGACCGGGAGCGGCTGGCTTATGAGCGTGAGCGTCTCGAGGTCGATCGGAAGCTGGCGAGCGTGTTAGCTGAGCAGGTGGCTCAGA
ACCAGCGCCTGCTTTTGGCCATTGTGGACAAGCTCAGTGCCAAGTAGCCTTCTAGTCTTGAACGTTTTTGAAGCATTGCATTCAAAACTTGTTGGTTGTT
CGCAAAATGTGATATGGAGAGATCAACCCGATAACGGATCCGCGCCAAGAAGCGACTCGAAAGCCGTAAGTAGTTTCTGCCAAGCAAATCCTACGTGGTG
GGATGCGCTACGAAGAGCTAGACGAGATATCGTCGTCGACAAAGTCGAGCGATGGTCCCGCCAAATTATCTCGCTCGTGGAACCACGGTTTGGCATCTCC
ATCCGCTCGTCTTCCTCGACGTCGAGCGACATCCGACTTGCTCTTCGTCGCACATCGTGGCCGCTTGGCAAAAACGAATATGGAGAGACAAGTGACGGCT
GGAGCACCTTGCCGATCGTTGAGCTGGGAATGTATATGAGCAACTGTGCCTAACGGGTTGATTCAGCAGAAAACAACTCAAACTCAAATTTGAGGTCTCC
TTTTCTCAATTTCGATGCCAGTCGTGAGGCCACTAGCTGTACCACATGACAGTTCGTTTGTCTACAGTGGCCAAAAGCAGGCGCTGGTTTGGAGCGACCT
CCTCAGCTAACACGCTCGGCAGCTTCCGATCGACCTCGAGACACGCATGGTCAACGCGAGCTGTTCCTGGTCAAGACGATCTTGACCAACACTCTTCTTT
AGACTAACACTATATGCGTATTTCATTCAAAACGCCAATAGTGTATCATATGCTATTTGCGGCGGATTCCAAGAGTGGCCGAGTTCCAGCGA