Description :
From Genome Similarity Track
Location :
contig_75:46300- 47707
Sequence
1407 bases(100 bases per row)
CTGCATGGTCCTGAAGCGAGCTCTCGCTCTAGCTCCTTGATTGAATTCATACAGGAGAGCACCACAACTCAGTTGCGAAACTGGTAACCATTCTGGTTCT
TCATAGCCCTTCCATTTCACGAGATACTCTCGTGTGCGTCGTGCAGTTCGAGTGCGTTTATTCCAACGCAGATCCAGAATTTTCTCAACTTCAAACTCGT
CGTTCAGATTGTCTGCCTCCCAGCTGTCCTCGGGTAACAAAGCGGTGTCAAAATCATCATCCTCGTCCAACTCGATTGCTTCAACTGGACGTTTCGGGAA
CAAAGCTCTCGGTTTCAGGCGACTCACATGCACCCAAGGGTTGACCCGATATCCAGTGTTGGTGACTCTCAGCTTGACTCTGAAATCATCATGCATCTCA
TCTATCCTGAACGGACCATGCCACATATGAGCCAACTTCCTGCTCAAACCAGTCTGCACCTTGGGGATGTATAGCCATACAGCATCGCCAACCTTGAAAC
CGGCTTTGAGACGCTCTGACAACTCCTTCCATTTCTCCGTCTGAGCTTCTGAGCGCTGTCGTTTCGCCTTTATCTGAAGGTCTTTGGCACAGGCCTGGGC
GTAGCTATAGTCACGTTGTAACTTCCGACGCCATTCGTAAGCGGTACGTTCAACAACGCCTGAAGGTTTGGGTCCAAGCATTGCTGACACCGTCCCTTGA
GCATCCCAACCATGCACCAAGTAAAATGGTGTATCTAACCGGGTGGCGTCAAAAGACGTGTTCAGGGCAAACATCAAACGTTCAGCGTGATCGTCCCAGT
CGCTTTGATCTGATTCAGCCACGTAAGCACGGACACTTCGCATTACCGTTTGGACCGACCGCTCTTGCTGGCCGTTAGCTTGAGGTCGATATGCTAGGGT
TGCTCGTTGCCTGCTACCCAGCATTTCCCGGAATCGGGTAAAAACTTCACTCATGAACCTTGGATCCTGGTCATGCCTCAGCATTGAACTTGCTCCGAAA
CGCCTGAACACACATTCCTCGTAAGCCTCAGCAACTTCTTGGGCAGTGGTCGAACTCATGGGCTTGCACATCACGTAGCCTGAAAATGAATCCTGAAACA
GGAGCAGAAAAGTATTCCCGCGTTCAGATTTGGGCATATGGGTGACAAAGTCCATTGACACTAGCTCAAACGGGCGCTGAGGTTCGATATTTCCAGGTGA
AGGTCCAGAATTAGGAGGTCGTCCCTTGGCCGACGCACAATCAGTGCACTCTTTGACAAAATCTCCACATCAGCGAACATACCTGGCCAATAAAACTCTG
CACACAATCGTTGATACGTGCGAGTTATGCCTTGATGCCCACCTTGAAAATCCTCGTGCACATAGTGCAACATGTCTGGACGCAAGCTTTCAGGAACAAC
TAATCTC