Description :
From Genome Similarity Track
Location :
Scaffold_1106:463- 3145
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1106-snap-gene-0.5Chaperone activator Sti1

Sequence
2682 bases(100 bases per row)
GTCGGGCACGCACCACGCGCTGCGGCGCCACCGCCAATTCGACTTTCGCCTGAACGAGGACGAAACGGCACGGCTCACACAGCACGGGTTCATGGTCAGC
GAGCGGCTGCGTGCTGAGAGCTTTGCCGAGGTGTACTACCGCCTCTATTCGGACGATATGCCCGTGTTCATCACGAGCGACTCGGTGCTCCACGCNNNNN
NNNNNAACACAGCCACGATTCTCGACGGGATTCAATGCGAACAGCTCACAACCATCACTTTGTTTGGCACGTCTCGNNNNNNNNNNGTGGCACCGCAGCT
TTGACGCGTTTCTCGTTGAGCTCGAAGAGGAGGAACTGACGCCGCTGCTCGAGAAGATTGTGGACGACGTGCGGCAAGCGAGTGAGCGCACGACCCCCGC
ACTCGCGGCGGCAAGCGTGGCCCGCGATGTCGATACCTTTTTCGCGGTCGCGCACGCGTTACTCCTGGGCAGTACTGATAGCGAGAAGACGGACGCAGCC
ACGATTCTCGACGGGATCCAATGTGAACAGCTCACGACCGTCACTTTGTTTGGCACGTCTCGCGAAGTGGATTTCTCACTGTTCAAACCGCGCGGCCACT
ACACGAAATCGCCGGAACTCGGGCAGTTCTTCCGGGCGATGACGTGGCTGGGCACTGCGGACTTTCGCGTCGCCGGCACGGGCGACCCCGCGAGTGAGCG
GCACCAGCTGCAGTGCGCATGTCGCGTCGTGCAGCTGCTGCGCGACGCTCAGGTCTTGAAACGTGTTGAGGCGTTTGCCACGATCCTCTCGGTCCTTACG
GGCGACGGCTATGGCGCCGACAGCATGACGCCGATGCAGCTCCACGCACTGCTCGGTGATCGGGATCTCGAAGCACTCTATTTGAGTGGCGACAGCGAGA
CGCACCTCCAGGATCTCCAAGACGAAATTTCAAATCACCGACTCGGTGCGCAGGCCATTGCGGGCCATCCACTCACCGAGTCGGCCGCGGCTGCGGCGTC
CCCCTCTCTGCCGATGCGTCTGCCCACGTCGTTTGCGTTCCTGGGGCAGCAGTTTGTCTGGACTGCGTTTGTGTTTTCCAAGCTCGTGTATGATCAGGTT
CTGGACGAGCACCAGAACAAAGTGGCGCGGCGCCTGCCTAGTGCCGTCGACGCGGCGTTTGCGCTGCTGGGCAACAATGGTGCGACGAGCGAACTCGCCA
CGCGCATGACCGCAACGCCCAAGACCAGCCCCGACTTTGTTCCGCTCCGAGACGGTCTCCCGTACGCGGCCAGCTTGGTTGCGCTGCGCCACGTCGTTGA
CGCAACGCTCGCCACTGCAGAGCCAGCGTCCTGTAGCGTGGCACTGCTGTTGCAACTCGCACTGCGCGAGCTGTCTGCCGCAAGTGCCAGTAACGCCACG
GTATTTCAGTCGCACGCGTGGGCGAAGCGAACGATGAACACGCAGCTCGCGTCGCTCGCGCAGTTGCGCCACGACACGATCCTCTANNNNNNNNNNAGCT
TCACGATGGGCACACGCTGTGAGTACGCCGCCGGGTTTGTGGATCCGTACCCGGGGTTTTGGTACCGAATGCAGCAGCTCGCGCAGCGCTCGCGAGATAT
TGTGGGTCAGCTCAGGGCACTGAACGCAGACGACGACGAGTCGATGGTGCAGTACAAGGCGCGCGACTTTTTCGACAATAGTGCAGACGTGATGCGCCAG
CTTGGCGAGATTGCAACGGCTCAGGCGACGAAGCAGCCGCTGCGGGACGAGCAGGACGAGTTTATCAAGAACGTCATGGAGGAACGACACGGCAGCGGCG
GCTCTCGGTACATGGGCTGGTACCCAAGTCTGTTTTACGCGCATCGAGAGGACTCGGGCAAGAAGGACCACGTCGTGGCCGATATCCACACGGACGTGCC
GTCCGTCGAGCATGGCGACCCCGGTGGTATTCTTCATACGGGCGTGGGGGACGTCAACATGGGCTTTTTTGTCGTGGACAAGGTCATGTACGCGGGCCCA
GTGTTTAGCCACTACGAGTTTGTGACGCCCATTAATGCCCGACTGACGGACGAAGAGTTTAGCGAGCGGCTCAGCGAGTTCCAGGCGCCAACGTGGGCGA
CGGAATCGTTCCTCGTCCCCAAGTAATTGCATTTTGAAGCTCACACATTCAACCCATTCGAGTCAAAGGACAACAGTGCATACCTCTTCTCGTTAAATAC
CTGGATCATTCTCATCAGCACTCACTCAATCCCCAACGACACCATCCATTCTTTCAGTCAGTTGGCTTATGTGTGCTGGTGACGTGTGGCGTGCCGCAAG
TGTGTGAGCGTGACGTTGAGCGCATGGCGTAACTGTCGCGAGTGGACATCGAACGCGAGCCCGCGCTGGAAAAAGCCCGTGGCGTCGGCGAATCGTCCCA
GTCCGTACAGCGCATACCCCGCCCGAAAGTATCCCTGCAAATCATTAGCCGAACGGTAAGTATAGTCAGAGAGGGGGGTATCACAGGGCATTTTAATGAG
CTCACCACTGTCGCGGTTGGCTCGAGTCGGACGGCGTCTTCGGCATCTCGCAGGGCTTCGTCAAATCGCCCCAGTGCGGCCAGGAGCGTCGACCTCCTTG
TGAAGAGAACCGCCATATCCCGTGGCGTCTCGGCGTGGAGCTTGATGAGCTTATTGTACTGCTGAAGCATCCGCTGGGCATC