Description :
From Genome Similarity Track
Location :
contig_74:463- 2184
Transcript NameFunction/comments
g10033.t1hypothetical protein

Sequence
1721 bases(100 bases per row)
CGGGTGGGCAGCACATTCGCGGGATTCGGGGGCCGGCGGCCCGTGCGCACGCGGCGGAGTTCGGGGGGCCGGCGCCGCGGCAGCTGCGGCTGCTGCGGGC
GTCCAGGGTGACCCACCGGCGGGCAGCATGCATGCCGCCCTGCCGGGTGGGCCATCATCGCGTGGGGGTCGTGGCGGCGGCTGGCGGCAGCGGCGCGGTC
GTCCGGCGCGTCCTCGTCGTCGCTTGAGCCGTCATCCGGGCTCGCTGGGGCCGTACGCGGCCGCGAGGGCGCGAGCCGTGGCGGCTGCAAGCGCCCCCAG
GCACGACCGGCACGGGCAGCATGCCGCTCGCCCTGCCGGGTCGTGCCACATCACAGGGGAGCTGGGCGCGGGCGACGGGCGGAGAGGCGGGCGAGGGACC
TTGGCCAGCCAACGGGCGCGCGTGGGGGGCCGGCGGACGTCTGGGCGTCGTGGCGGCCGGCGCTCGGCGGCGCTTCTTCGGCGGCCGGCCGTACGGGCTG
AGAAGGCTCCGTTTGTGGAAGCGTCGCCCGTACGGCCTGAGAGGCCAGCATTCGGCCGATAGTGGGGCCGAGTGGGGAGGGGTGCGCCGACCTCCCGCCC
GCACCAGCGGACCGTCCACTGTCGCCAGCGGACGGTGGATCCACCCGTGGATCCCCGAAACGACGCGAGGTCGTGGAGGCGGGGCGGGGCGTCTCTTGGC
CGGCAGCGGCCTCGAGGCGCGTGAGGGGTCGCGGTGCAATGGGCGCTGCGGGTCCCGGACCCGTGCCCGAAGTTGCAGCCGCTGAAGCGTCGCCGGTGCC
GCAGCGCTCTCCGGGTCCGTTTCGGGCCCGGAAAGGGCCAAAACGGGGGCGAGCGGATCCACAGTGTGTAACCGCACCCCTAGTGGATCCGCCCACCCGT
CCACTGCGCCACCGACCAGCCCACTCTCGTCACCGACCGCGCTGTAAAAAGACGCGTCGCTGGCGAGACTGGATTGGCTGGCTGTGGAGCACTCGCTGTC
GGTGGACAGTGAGCGCTCCCTGATTGGCCAAAAGAACCGCATCGCTGCGATCCTATTGGTCAAAAAGGGTAAAGGGACAATGGAGGACGCAACGCGGACC
GAGGTGGACAGCCGAGGAGGAAAAAGATAGAAAAGATGCAAATGTAGTTGGCCTCGCGGGGGAAAGGTGAAAGCCCCCGGAAACCGCCCCGTCCTCGCAC
AGCAAGCTGCGCGACAACGGGATGCCCAAAAATGAATGTGAAAAAGACCAACGAAAAACGTCGGAAACCAGTTTTCACACTGATTAGAACAGATACTACA
CTTGATCTTAGCCAAAAGGCCGAGAAGGTATTATACGTTGAATTGTGTACAATCGATACAAAAGTGTAAATAAATCATACATACATACATGGTTATAGTC
TGCTACCCACGCGTGGCTATTTAAAAAAATGCATGTTTAACGTAACATTCTATTGTCAGTATTAATAGCGAATCATTTGGTCGCAATTGTTATTATTGGC
AAGCACAATTCTAAAATATGACATTTGATCAATTACATTTCACAAAACGAAACAAAATGTTTGGTTAGCAGGGGCTTTCTATATAGCTAATAAGGTTGAG
GCGCCAAATGGGGGAGTATAATTTGAAATATACAAGCAAAGAAAATAAGAGAAGTGTGGTGGTTGGCCTCGCGGGGGAGATAGTGAAAGCCCCGGAGACC
GTTCCAAGAAAAGCTAGCAAG