Description :
From Genome Similarity Track
Location :
Scaffold_2497:463- 1550
Sequence
1087 bases(100 bases per row)
AAGAAAGAGCCCCAAACGCCAGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGAATCCGCTCGTGTACGA
CGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAGG
CGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCGAAAAGGTTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGT
GCGAGGCGATATTGACTGCGAGGCCCCTGCCCTAACACGGTTACGGCAGAAAGTGATGGTCCACCTGCATGGTTGGATGAATCACGAGTTGGTACATGTC
AAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCG
TTACGTTGAACCGATTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGCAAGGGTTGGATCCAA
CCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTTAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTAT
CTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATT
GCCCCCCTACGAAGAGAGTCAACAAGGATCGGGATGGATTGATGAGATTGGTGATACCGGAAGCCTTACAACAGGATGTCCTACACCACTATCACGCTAG
CTTGGAAGGCGGACATCAGGGGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAACGCATGGTGCAGACGATCACG
AGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATGAACACCGCC