Description :
From Genome Similarity Track
Location :
Scaffold_3:462901- 465756
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01310pre-mRNA-splicing factor ATP-dependent RNA helicase

Sequence
2855 bases(100 bases per row)
CGTGGCAACACCGAGCGCAGGTCGCGTCGCTCCGACGGCTTCTCCCGTCGCCGCCGACGCTCTGACAGCGGCGACAATGCTCAGTCTGGTTACAAAGACG
AAGGTGATGGCTCTGACGTCGAAATTATCAGTGACTTCCGCTCCAAACGCGAGCTAGAGACTGCGCAAGACGAGGCCAAACTTTCGCCCGACGAGCGCGA
GCGTCTACGCGATCGTGAGGAGCGCGACGCCTTTGCCGAACGGCTGCGTCAACGCGATGAGGAACGCACCAAACACAAGCGCAAGGCCGAGGAGATTGAG
GGCCGCGGTGGACTCACAAAGGACGAGATCAAGCAGCTCGCCAAGCGAGGGACACTTGACGCCGGACAGAGCGAAAAACTTAACCAATTGAGGGAACTCA
GTAGACAAGAGTACCTTAAAAAGAGGGAGGAGAAGGAATTAGAGCTACTCGAGTTCCAATTAAGAGACGAGGACGTGCTGTTCCAAGAGACCAAAAGGTC
CAAAAAGGAACAGCATCAACTGGAACTTAATAAGAGGATCTTAGAGACAGCCAAGGCCAGATCTAAGAAAGAAGAAGTCGACGGGTATCAGATTCCAGAT
TCCTACGAAGAAGTGGACGATGAGGGCAATCGAATCCGGAAGAAACAGGACCTTTTAACGGACAGATACGAAGAGGAAGAAGTGGTCCATACTGAGCAGG
AAGTATGGGAAGAAACGCAGGTGAAGATGGCTACCAGTAGATTTGGAGCCAAGGATAAACACAAGGAGATACAGGAAGAAGACGAGTTCGTATTCGACGA
CCAGATAGATTTCATCTCGCAGCAGATGTTGTCGGGACATCATGTGAGTGACGAAGATGTCCAAGAGGCGAGGAAGAAGATGGAACAGGCCAAACATTTG
AGTATCCAAGAAGGAAGGAAACAGCTGCCAGTGTATCCGTATCGAGAGTCTCTGTTGGAGGCGATCCGTAATTATCCAGTGATTATCATTGAAGGAGAGA
CCGGATCCGGTAAAACGACGCAGATCCCGCAGTATTTGCATGAAGTTGGGTACTCGGAACTCGGTATTATTGGCTGTACACAGCCTCGACGTGTCGCTGC
GATGAGTGTAGCAGCTCGAGTGGCTCAGGAGATGGATGTGAAATTGGGTAATGAAGTGGGCTACTCGATTCGTTTCGAGGACTGTACTAGCGACAAGACA
GTGATCAAGTACATGACAGATGGCATGTTGCTCCGAGAGTTCTTAACTGAACCTGATCTCAAGTCCTATAGCGTCATGATCATCGACGAAGCTCACGAAC
GCACGCTTAGTACCGACATTTTGTTCGGTCTGATCAAGGATATCGCTCGGTTCCGTGACGATATCAAGATCATTGTGGCTAGTGCGACTCTGGATGCCAC
CAAGTTCAGCGCTTATTTTGACGATGCCCCGATTTTCAAGATCCCTGGGCGGATGTTTCCTGTGGATATTCTGTACACGAAGGCTCCCGAGGCGGATTAT
TTGGATGCTGCGATCGTTACAGTATTGCAGATCCACATCACCCAACCACTTGGAGACATTCTCGTGTTCTTTACAGGTCAAGAAGAGATTGAAGCTGCAG
AGGAGATATTACTCCAAAGAACTCGCGGTCTTGGCTCTCGAATACGCGAGTTACTCATTCGACCGATCTATGCGACGTTGCCTTCCGAACGTCAAGCCCA
AGTGTTTGAGCCAACACCGGAAGGGGCTCGCAAGGTGGTTCTAAGTACGAATATTGCCGAGACCTCACTGACCATTGCAGGTATCTGCTACGTGATCGAC
ACGGGCTTCTGTAAACAGACTAACTACAATGCACAGACTGGAATGGAGTCGTTATTGGTGGCTCCAGTCTCACAGGCTATGGCCAACCAACGTGCGGGAC
GAGCCGGTCGTACAGCTCCTGGCAAGTGTTTCCGTCTGTACACGGCGTGGTCGTACAAGAACGAGTTGGACGAGAACACCGTGCCAGAAATTCAACGCAC
AAACCTTGCCAGTGTGGTGCTGCTTATGAAATCGCTCGGAATCAACGATCTTCTCCACTTCGACTTCATGGATCCTCCACCAGAAAAGGCACTTATTCGC
TCACTTGAACAGCTTTACGCTCTTGGGGCCTTGAATGGTTTAGGTGAGTTGACAAAGCTGGGTCGTCGCATGGCTGAGTTCCCGTTGGATCCCATGATGT
CCAAGGCGCTGCTTGCTTCGGAGAAGTTTGGCTGCGTTGAAGAAGTGATGACGGTCTGTGCCATGCTAAGTGTGAACAACTCGATCTTCTACCGACCGAA
GGACAAGGCAGTCCACGCTGATAACGCGCGTCTCAACTTCGCGCGAGGTGGCGGTGGAGACCACATCACGTTGATGAACGTCTACAATCAGTGGGTGGAG
ACGAACTATTCGACGCAATGGACTTACGAGAACTTTGTCATCATGCGTTCGTTAAAAACTGCTCGAGATGTTCGGGAGCAACTGGAAGGTCTTTGCGACC
GCGTGGAGCTTGAGCGCACTAGCAACCGCAGTGATCATGAGCCCATCCGTAAGGCTATTTGCGCTGGTTACTTCTACAATACTGCCAAATTGGACAACTC
TGGACACTACAAGACCGTGAAGAAGGCCCAATCTGTGCACATCCACCCGAGCTCGTGCCTTATAAAACTAGAGGAAGTCCCGCGTTGGGTGGTGTATCAC
GAACTGGCCTTTACGACAAAGGAGTATATGCGCAATGTGATCCCCATTAAGTCTGAGTGGCTGATGGAGCTTGCACCGCATTATTATAAAACCAAGGAAG
TCGAGGACGCTCGCACAAAGAAGATGCCCAAGGCTGTGGGTAGAGCAGGTTAACT