Description :
From Genome Similarity Track
Location :
Scaffold_6:46289- 47298
Sequence
1009 bases(100 bases per row)
CGGCGGCGCTTCCTAGCGCCGGATGGCTCATCATGCGTGCGTTTCGCCATTTCCGACCAAATTTCTAAATGATGACAAAAACTTGCTGGATGGATGTCAT
GCGTCGTCTACTCGTCAAAATTATAAAGGATTACAAAAACAGATATTATATCGCCACGTTAAATTTGAAACAGTGAAAAAGTCAGGATATCAATTTGTAA
AGTGCTCACGGTACGGTATGTGAATGGGAAGGCAAAGTACCATACACTGATTAACTTATCCATACATAGTGTAAGATATATGCACCCGTTGAGTGCAACA
AGCACCATACTAAGATTCACTTATTCATACATAGCGTAAGAGATATGCACCCGTTGAGTGGACAAGCACCATACAAAGTTTCACGTGTCTATACGTAGCG
TTAGATACATGTACTCATTGACTGAAGTACACGGGACTTCACAAAAAAAAAACAGCGTCGAGGGTCTGCCTTGCTTCCAGCTAGATATGCCTAAAGATGC
ATCTTGAGCATCACGTAGCAGTTATAGATAGCTCCGTCTGATCGTGGTCGTCTGTAGGCTGAATTAGGTCGTAAATCTTTTGTTTTTGGCGCTCATTGAT
GCTGGGACCGCCAAACCGATACGGTGAGCATCATCAACTGATCAACGCTGACGCAGAAACAGGTCGCCAGGGCGAATATCTTCGTATTTTCGAAGCTATA
TTACTATATATTACCATGAAGGTACGTTGTACCAATCTGTTTTGATCAATCACGGTAGTTGAAGTCGCAATCGTTCCTAATGATCGTATATTAGCCAATC
AAATTAAAACCTAAAAGGGCGAAGAAATCGCCCTTGTACGTCGTGGAGTATCAATTCCAACTGCATCTTGTGTGATGTGTTTATCCCCCCGTCTCTATCG
ACAGCTTAAAGGGCGAAAGAATCGCCTTTTTACATTGATTTGACTTATCGTTGTATAGTATAGTTTCGAAGAGTCTATAGTTGCTCCTCGCGAAAGGGTT
AAAAGAAAA