Description :
From Genome Similarity Track
Location :
Scaffold_130:4628- 7155
Transcript NameFunction/comments
g10221.t1hypothetical protein

Sequence
2527 bases(100 bases per row)
CGACTGACCGGCAAAGCCAGGGAGAACGCTGCTGAACCCAAGTCAGCTCGTGTATAACGCTTTGTAGTGCAATCATGGAAAGCGCTCCAGGTCTCCGATA
ACTCTGTGTACTCGCTTGTACGCGAGTACGAAGACGTCTTCTCTGATAAGATCACAGCGAAATTGCCTGCGGAGCGAGGTGTTCCACACGAGATCGACCT
CGTGCCCGGCGCGAAATACTGCCTAACATAAAAGTGGCCTCGGCTGCGGAACCAAGACCAGGTGATCGATGACTTCTTCGAGGGCTGCCGCACAGCAGGT
CACGTGCGCGAAAGCACTTCGCCACATTCGAGCCCGACCTTTTGCATGAAGAAGGCGACCGATGGGTGGCGCATTGGTCACGCCTTCAACAAGCTAAACG
ATGCCACCATCTCCGCTCAAACACTTATCCTGAGAAAGGACATGGTGGTGGATTCCATGTCGTGCAGTGTCATCTACAGCGCCATCAATCTGACAGACGA
TTTCAATCAGACCCTCATGAAGAACTCCGATGTTCCTCTGCCTCTGGCGGCAGTGAGCCCTCTGAGCGGCATATCCTTGGAGTGGATCGTAATGACACAG
GGCCGGAAAAACGCACCCGCGACATTCAATCGGATGGTGTCTCAAGTCCGTCGGCCGCTCGACAACTTCGCGCCGAGCTATTTCGATGGCATCGTTATGC
ACAGCCGCGCTGAGAAAGAACTCAGCGACGTCCATCTTCGTCACGCGAGGCAAGTCTTCCAAGCGACGCGCGAGAAGAAGCTGTACGTGAATCTAAAGAA
GTGTGTATTCTGTACCCCGGAGATTTCGGTGCTTGGCGGCTATGTCAGCAAAGATGGCGTTCACACCGACCCAGAGAAGGTGTCTTCGATTTGCTCTTGG
CCGACGTCCAAGATTCCAACCAAGCTGCGTGAATCGTTGGACCTCGTCAACTATCTTCACAAGTACACGAAGGATTATGCAGGGCACATTCAACCCCTCT
CGTCATTACTGAAAAAAGCCGCTGCTTGGGTCTGGCGTTCTGAACACCAGGACGCGTTCTCTGGTGCGTAGAAGACCCTTGCCTCGGCTCCCGTCTTGAT
GATCCCGGATACATTACGACCATTCCACGTCGTGTGCGACGAAAGCAATTTTGCGATCGGTTACGTACTCGTGCAATTCGACGATGAGGGTCACGAGCGC
GTCGTGAGCTAATAGTCGCGACAGATGAAGCCGACAGAGAAGATTTACCCGATGCACGCCAAGGAGCTTCTCGCGAGGCGCTACTATATGATTAAATTCA
GAGTATACCTCCTGGGCGTACAAACCTTTGCGGTGTATACAGATCACACGTCGTTGCGGACGAGCTCCCATCTATCCCAACGAATGGCGGGATGCCCCCC
TTCACGGAGTACAGCTTGGTCGTGTACTACAAGCCATGCAAGAACAACATTCCTGACGCGCTCTCACGGCGCCCAGACTATGCCCCCCGGCGCCTAGGGC
GTCATCAGGAGATCCTGATGACGGGGACGACGAGAATTGCGGGGTGTGCAAGGTGCTCTGCATCACCGAGTCCGGTGCTGCCCCTCAATCAACAGATGAC
TAATGCGTACGGAGCGGGTTTGTTTTACGCCTCGATCATGACGCACTTCCGCAATCTCTCCGCGGAGGGGCTGGTGAAGCTGACCCGTCCAACGCGTGCG
CACACCACGCGCTACGCACTGGACGATGCTCTACTGATGTACACGATCGACAAGCTCGACGCTCCGCCTGTCATCATTCCTACCGACGACGATCACCCTG
TTGGTGCATGGGTTTTACGATGCGCCATCGGGAGGCCATCTGGGCCGAAAAGACCTTCTTGTCGATCTTCCAGGTCTTCTGGCGGGCCCACATGTACAAG
TGGATTTACATGTATGTGAAGACCTGCAAGCCATGCCAGCGTGTGAAACCTGTTGGGGATGCCTCAGCTCCTTTACACAGCCTATCAGTCCCGGAAGACT
GATGGAATTCATTGACTTCCGACTTCGTCTTTGGACTACCCGATGATGCCCAAACCAACACCGGCGTCCTGGTGTTTGTCTGCCGTTTGAGCAAGATGGT
ACACCTCGCTCGGGTAGCTGACTTAGTCACTGGGGAACAGACTCCAAGGCTGGTCCTGGATGGCGTCTTCCTCTATCATGGCCTTCCGGAAACTATTGTC
TCAGACCGTGACCCAAGGTTCACGTCTGCGGTTTTGAAGAACGCTGTTCCAACTGCCTGGAATGCGGCTGCTCATGTTCACGGTCGATCACCGACAGACG
GATGGCCAGACAGAGTACATCAATCGCGGGCTCAAAGACACTACACATGTGCGAAACCTCCCCGCACATGGTCGGCTAGTTGTCGATGGTTGAGTTTGCA
CTCAACAACACGGTGTACGCGTCGACGAGGCTCACCCCGTGCTACCTCAAGGGGCTTCGGAACCCCCCGGTGCCACTCACTCTCCGTGGTGGCACCGCGT
CTTCGGTTGTAAGTGGCGCGGGGGGGG