Description :
From Genome Similarity Track
Location :
Scaffold_1779:4627- 6931
Transcript NameFunction/comments
Phypl_g14132hypothetical protein

Sequence
2304 bases(100 bases per row)
TCTGACGACTAAGGATCACCTCAAGCCCCACAAGACACCATCTACGTCTGTATTGCTCACGGTAAGTCATTGAGAGGCGTTTCTGGTGCCTCAGGAGGGG
GCTCTGACCTTAGCGATGATGACTGTGGTGTTTTGATGCCATACTACTAGATCTCAAGCACATCCTCTCGTACGTTTTCGACGACGGCTTTTGTTGTGTG
TCTCTCGTTCATGTGCGGTTCTTTTTTGCTGGCTACGTGTATCAGGACTGCAAGATTCACAAGGAGAGCGACGGCCTCgcagcggtggagctgcaaAGGC
GACGAAGGGAAAAGGAAAGAGGAAGCAGCGTGCTGCAAATTGGTCGACTTCTGAGGTATGCGGGTATCAGTTAACGCTAGAATGCAAGGTATGCACGACT
TACCTATTGATTCCTGTTTCAGACGATCGAGTTGTTGATGCTGCGGTTCCAGACAGAGGGCATCGTTGCCAACTTCCTCAACCAGCGCCTCAAaggcgag
gagaagcctAACTGGAGCACTGTGGCATCTCGGATGAGCACCGAGCGTGAGTGGGATGAGTGCCAAAATCGCTTGAAAACTCTCACCTCACAGTACAAAC
TAACAcgtgcccccccccccccccccctggTAATAGTGTTTGTGTTTATTATGTGTTACTGATaccgttgctgttgctgctgtagaaACTCATGAAGGAG
GACATGCGTACTGGCAACAACACGGAATATTCGGTGGAGTACGCGCCGTATTgggacacgctgctggaatgCTTGGGACCGTTCAGTGGCCTCACTGAAA
ATGCTGTTGCTGACAGCGAGGGATATCTAACGACGTCGTGCTCCGCAGCAACTGCAGGCGAGGTCTCAACGGGCTCCAATAGCGACGCTAACAGTAACGA
TGAGGTCCAGACTAGTTCGGCGGCACCTGCAGCTACACAATCTTTCGGCAAGCGGCCTTCCGTGTTTTCACTGGTGCAGGTTGCACCAACCAAGTGGACT
AAGAAGGGCCGTGATCTCTCCACATTGGAAACGTCAGTTTCCAGCCTGGTTGACCATATTGTGGGGAAATCGCCACAAAaaaggacgagctggctACTGT
CCAGGCCGACGGGGCGTCAGTTCGCCAACAACGTGTTGCGGTGGGTGATCGAGTTGCTGAAATGGAGTTAAAACTTGATTCAGTAGCTGACAATGTCGCG
ACAGACGTAACGAAGGCTGTGCTGGGATGTATCCCCTCTTTAGTCGCGCAAAGCTACGGTGACAGGTTTTGCTTATACGGTTACTGTGTTGACCAGCAAT
CTAACTATTTCGTTGCGCTTTTGTTGTCCTGCTAGTAGCTCTTCctcggcttcctcttcgccgtGAAATACtgccagtgctgctgcactgtcgtcctcgt
gctgATCCATCTCATCGCGTATGGTGTTGTCGCTTTCGCCTTGAACCAGGGTAGCCAACACCTCCAACGATCGTTGCTCGTATGTAAGCGCAAAGTTGTG
TAACACGAAGCAACTTACAATTACTTTTccgtcttcagcgtcttTATTCATGTCAATCTCCCGCCTTAGAATTTAAAAGCGGCCTTTCAGTGCACCGAAT
GCCATTTCCAGGGTGCTCTCGATGTGGCATTCTGTGTCGAGAAAGTGCGAAATGCCGCATTCGGAGTTTCAGGGAGTGCCGCAAAAATAGACATGGGTTG
ATTGAAGTGTAGACAAAAAGGCAGCGCCCAGAACAGCAAGCACGTGGGGTTACCTTGCCTCCAGCGGAGACATTGTCGTTATTCGGCTCCCAGGCGCAGG
CAATGGAAGAAAGCAGTACAGACGATGCACGTAGCGACCCAGACAGACAGCGCTGCATGAACGCGGTTCTCGGCTACCCACGGAAAAAGACTAAGAAGGC
AGAAGCAAGGTACAACTGGGTAGAACACTATCCAGTAACCTTGGGGACTCGCCCAGTCGTTGCCGTTGTTTCCGGAAAGGTGGAGCAAGCTGTGTGTCGA
TTTTGTGAGCAGTTCAAGCGCGAAGGGAAGGCGGCTTCTACTGAGGAGCTGGGTCTTATCCTCAAAGGAAACACACGCAAGCCACGGTCGAATATCGCAA
TATTTTCATCGTTTCGCAAGGACATTATCGTGCGGCATCACGAAAGCCAACACACTTCTAAATGGGCAGAGTATAAAACTCTCCCAAAAAACGAGTCCAT
TCGAGAGCGATTTTTCTCGGATCCGGATTTTGCTGCGAGTATCCTGTCCTATACTACACACGCCTGGAGAAGCAGGGTATCGATCCCTGTACCTCTCGCA
TGCT