Description :
From Genome Similarity Track
Location :
contig_24:462666- 464103
Transcript NameFunction/comments
g4610.t1hypothetical protein

Sequence
1437 bases(100 bases per row)
GCAAGGTTAAATGTCCACCCTTTAACGATCGCGGCACCCAGAGTACTAATGATCCTCCGCCGGATCCTGGAATGCCAATAATATTTGGGCGCCATCGATC
CAAATACGTCTTGTCTTGGAGCTCAGCAAGTGTGGCATTCCATGTCGTGGTCTTGCATGAGTTGACTTTGACTTCCGCATAGTTGCTGCCACCCGAATGA
ATGACGACTGTCACGTCTTTAGTGTCTGTGCTCTTGAAGATGATGTTCACCATACCGTCGCCTTCCCTCGTCCAAGACCCATAGCTGCCTTCAAACGCCT
CGTCCACAGTTGTAAGTCCTAGAGCGTCGAAGAGCGTACCGTCGTCAATTTCTCCGATAAAGGACGTTGGTCCGCAGGTTGGCTGAACAAACTGCGACAT
CATCCAAATAATTCCCATCGGATCGAGACCAGCTAGTACAACGAGTCCCAGGTTCGATGCTTCGAGCGTGGAGTCATCCTTTGCAACCGAGGCTCCCATA
TCTGTATCGTTAGATAAGATCAGCTGGTCATGATAACACCCATCGTCTTGCGAAGCAAATCACGGGTCTGGAAGGCAGCTTCAGTGGTCTTGTTGCCCAG
AATCTCGCCCATGCAGTTGTTTGTGACGACTGGGGCGTCGCATAGCACCAGTGACGACCTGCTAATTGTCACTCGAATATCATCTGTAGTGGCGCTGGGC
GTTGCGTTGCGAATGCTGTTGACTGCATTACTGACGCGATCCGTGAGACTTTTAAGCTGGTATCCGCAGGTCGTGTTGGAGTCCAAAAAGTCCTGCAGTT
TGACCAACGTCGAATCATCCTCCGAGTTGAGCGCGCTCACATTGGTAAGAAAAGTCATCACATCGGTTGCGGACGATAAAATCTGATCACCGTTGATGAT
AGCCTGCTTCACAATATTCTCCACAACCGTGACCACAACACCAGCTACTCTTGTTGCGAACGAAACAGGGTACCCGAGACAGGTGCAGACCGCGACAGGC
AAGTCCACGAGGACAACATCAGCCTGGTACGCTATCGCAAGTAATTCTTCGACAGAACCTTGAGGAGCCGTAGTCTGCTGGAATCGGAGGTAGTAGATGA
GGGATTTGAGCACGCCGATGATGCTAGCAGCACACATGTATGTCTGTTGTGTAAGCTTGTACGCGGCACCGACTTCACCAAATAGACCAGCAGTTGCTGT
ATTGACCATGACAGCCACCACCGACGCCGTCTTTTGAAGAATCTCCAATGCACAGTCATCGTTTTGCGGGATGCACTCCAAAAAACATTTAACTGGGTAT
GATAACGGACACTGTGCGATGCAGTTGGTGTCAGTCTTGTTGTAACCGAGCGGGCACACGCCATTGCTACTAATGGCCTCCGTCTTCCTGTAGCATGCCG
AGTCCTTTGCATCGCCGATAGTTGGTCCTACCCAGTT