Description :
From Genome Similarity Track
Location :
Scaffold_312:46265- 47682
Sequence
1417 bases(100 bases per row)
GTACGTCTGGGAGTGCCCGTAGTCGGCTCCCGACGTAGCAGCAGAGCCTCAATCGGATCATGCGAACGGCCTCGTCCGGATCGAACGAAGAGGCCCGTCG
GTCCACCCGCAGATGCAGGCTCGCGACCTCACGCTTCAACAGGTTCAGGCGGCCTGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCTGCG
TCACCGTCAGTTCCCAGGTCAAGTGCAATTTCAAGCACGAGGACACGCTGACGGAGGCGGTCAATTTCAGGGTCCTGTGTCGGACCCGCAGGAGAAGCAC
TCGGACGAGGGCACCTCCGCCCCTGCTTGACCGGAATAGAGAAGTCCACTACCACGTGGAGTCGATCCTCCAGGAGCAACGTGATCGCGGTAAGCGACAG
CTCCTCGTGAAGTGGAGGGGTTATACCCAGTCCAAGAACTCGTGGGAGCCGATCGAACGGCTCCTGATAGACTACTCGAATGCTGTAGTAATCTGGGAAT
AGAAACGGCGGTAACTTCATAGGTAGTCCGGGACTTCTTGCCCGAACGGGGTACGGACGTTGACGACACTCCGTACCCGCGCTCATCGTGAGCGCTAGAA
GCCCCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGACCATGTGGGCAAACCGAACACGAAGATCGTGCTGGTCCAGGATGCGGGACAGCAGCT
GATCTTCATGTAGTTTCTGAAACGCCGAGGCTGGGTACTTGAGAGACTCAACTCACGCTCAGAACATGTCCTCTCACGAGTTCCAGTTGGGACAGTTCTC
AGGAAGAGCCCAGGGGTGGCCCCAGAGAGGGTAAATACCACCTCGGCTCTCAGGCTTCTTACGACAAGTCGAAAAATCCTTAAGAGGGTTGCGGTGCTGC
GCGAGAAGCACACACCAAGCCGCCTCCAAGTTGTCAACAAACAACCGTTCCTTCTGAGCAAGGGTACAATCGTAAATGCCCCTAGAGGTGTGGCTACAAG
GCCACGAGTAGCGACGAGAAGCTCCAGGAAGAGGTCAGCCTCAGAGTTCTCCTCGGGAGGCCAATACACTCTTAAGTTGATGTCAGCTCCCTGGCTGATG
GGTGTCACCACCGAATTCCCACGCACACGCTGGGCAGCTTGGAAGTCCCCCTGCCGCTGGTCGAGGTCATTCGTGACCTCCCGGGGCTCAAAGATAGCAC
CCTCCTCCTCTTCTTCTTCCTCCTTCTCCTCCTCTGCATCCGAGGAGTCGAAGAGGCCCCGATGAGAGTGCCGAGTCTCCTTCTCCTCGCGGAGTGGAGA
CTTAGAGGCTGTACGCTTCTTGAGGGCTTGCCCCCTTCGACTTTAGAGGGCGTTAGCACGCGCAAGACCCTCGGTAAGCGAGAGAAGTTTGCGAGGAGTC
TCTTCCTCATCGCCACC