Description :
From Genome Similarity Track
Location :
contig_75:46251- 47715
Transcript NameFunction/comments
g11778.t1hypothetical protein

Sequence
1464 bases(100 bases per row)
CACAAGTGCTCGGGGCACTTTATGCTCTGGGATGATCATCTCCTGCCTGCATGGTCCTGAAGCGAGCTCTCGCTCTAGCTCCTTGATTGAATTCATACAG
GAGAGCACCACAACTCAGTTGCGAAACTGGTAACCATTCTGGTTCTTCATAGCCCTTCCATTTCACGAGATACTCTCGTGTGCGTCGTGCAGTTCGAGTG
CGTTTATTCCAACGCAGATCCAGAATTTTCTCAACTTCAAACTCGTCGTTCAGATTGTCTGCCTCCCAGCTGTCCTCGGGTAACAAAGCGGTGTCAAAAT
CATCATCCTCGTCCAACTCGATTGCTTCAACTGGACGTTTCGGGAACAAAGCTCTCGGTTTCAGGCGACTCACATGCACCCAAGGGTTGACCCGATATCC
AGTGTTGGTGACTCTCAGCTTGACTCTGAAATCATCATGCATCTCATCTATCCTGAACGGACCATGCCACATATGAGCCAACTTCCTGCTCAAACCAGTC
TGCACCTTGGGGATGTATAGCCATACAGCATCGCCAACCTTGAAACCGGCTTTGAGACGCTCTGACAACTCCTTCCATTTCTCCGTCTGAGCTTCTGAGC
GCTGTCGTTTCGCCTTTATCTGAAGGTCTTTGGCACAGGCCTGGGCGTAGCTATAGTCACGTTGTAACTTCCGACGCCATTCGTAAGCGGTACGTTCAAC
AACGCCTGAAGGTTTGGGTCCAAGCATTGCTGACACCGTCCCTTGAGCATCCCAACCATGCACCAAGTAAAATGGTGTATCTAACCGGGTGGCGTCAAAA
GACGTGTTCAGGGCAAACATCAAACGTTCAGCGTGATCGTCCCAGTCGCTTTGATCTGATTCAGCCACGTAAGCACGGACACTTCGCATTACCGTTTGGA
CCGACCGCTCTTGCTGGCCGTTAGCTTGAGGTCGATATGCTAGGGTTGCTCGTTGCCTGCTACCCAGCATTTCCCGGAATCGGGTAAAAACTTCACTCAT
GAACCTTGGATCCTGGTCATGCCTCAGCATTGAACTTGCTCCGAAACGCCTGAACACACATTCCTCGTAAGCCTCAGCAACTTCTTGGGCAGTGGTCGAA
CTCATGGGCTTGCACATCACGTAGCCTGAAAATGAATCCTGAAACAGGAGCAGAAAAGTATTCCCGCGTTCAGATTTGGGCATATGGGTGACAAAGTCCA
TTGACACTAGCTCAAACGGGCGCTGAGGTTCGATATTTCCAGGTGAAGGTCCAGAATTAGGAGGTCGTCCCTTGGCCGACGCACAATCAGTGCACTCTTT
GACAAAATCTCCACATCAGCGAACATACCTGGCCAATAAAACTCTGCACACAATCGTTGATACGTGCGAGTTATGCCTTGATGCCCACCTTGAAAATCCT
CGTGCACATAGTGCAACATGTCTGGACGCAAGCTTTCAGGAACAACTAATCTCAGCTCAGACTC