Description :
From Genome Similarity Track
Location :
Scaffold_1168:4625- 5850
Transcript NameFunction/comments
Phyin_T30-4PITG_22108Putative uncharacterized protein

Sequence
1225 bases(100 bases per row)
AACCAACGCCAGCTCTGACGACTTCTAATTCGGGACTTCGCTCCATCGCGTCGAGTGCGACTACACACAAAGGCGGACTAGTGAGCGATCTTTCGTGTAG
GTTCAGCGTCTGTTGCAGCAGTTTCTTCCATTTTGGAGCGAAAGTCTCGTGACGCCAGCCAGCCAGGCTCTCAGTTTAGTTCAGAGCCCTCCCAGCACGC
AGGCGAGCGAACTGGTCTCGTTCACTACCAAATACAAACCCTCACAGCACCCAAAGCAGAGACCATGACGGACGCAGAAGGCGTACAGCAGGAACTACAG
GACTACCTGCACAAGAAGGGCATTAACACGCTCTTCATCAACCTCGTGGAGTCGCTGCTACTGGCCAAACCGGAGAACCCGATTCTGCACATCATCCAGT
ACCTGCACACCAACTACCCGGAGGAAGCCACGCCGCGTCACAAGCCCGGCGCAAAGGATGTTAACCCTGCCTCACTACGTTCGCAATGTACGCGACGGTT
TGGAGCGTTAATTCTGGCAGAGAGAGGAGGGTATCTAACCGAGGGGTCTCTTGTCTGTTTTCACTAACAGATCACTCAGACGACAGCGAGAGTGAGGACG
AGGACGAGGGTGGAGACGCCGTCGGTGAGATCGCTGCCAGCGTGCCGCCACCCAAGATCATGGCCAAGGGACGACGCACTTCGGTGTCCGCTGAAACTAT
TGACCCATTGAGGTTAGTGACGGTAGTGGTCCCGTCCTGTCTGATGCTGGTTGCACTAACTTGACCCTCCTTGTTGTTCTGAATGTGACGTGACAGTGCT
CGCCAATTCGAGCGTGTGGTGCATCCCAAGTCTGCAGAGGAGAGGGAAGGAATCGGTCGCATGGTAGCCGAGAATATCCTGTTCAAGTCGTTGGATGAGA
AGCAGCACGATATCGTGCTCGACGCCATGTTCCCAAAGGAGTTCGAGCCCGGTGACATTATCATCAAGCAGGGAGACGACGGAGACAACTTTTACATCCT
GGAGAGCGGCGTCTGCGAGGTCTACAAGGACGGTGTGCTTGTTCAAACGGTGTGTACCCATTTTGATGTAGTAATAGTATTTTTGTCTTATACTGTGATG
CTGACATTTTGCTTCACCTAATGCAGTGTACCGAGGCGATGTCGTTCGGTGAGTTGGCACTCATGTACAACGCTCCACGTGCTGCAACTGTGAAGGCTGT
GCAACACTCGAAGGCATGGGCATTG