Description :
From Genome Similarity Track
Location :
Scaffold_140:4623- 6185
Transcript NameFunction/comments
Hyaar_Emoy2810875hypothetical protein

Sequence
1562 bases(100 bases per row)
TATGGACTTGATCAATGGCGTCGTCACGAGTCAGTCGCTGGTGTACAAGACGCTGGCGGAGACGGTGACGGTGGAAAGCTGCAGCTGCGACTACGACGTG
AAGTGGAACGTGGTCATGGCCACGAGCGTCTGTTGGACGTTGCCGAGCCCGAGAGCGACGGGGAAGAAGCGCAAACAGTTGATAGGCGCTCAGACGAGGG
ACGAGAGGAAGAAGATGTACACGAAGTACCGGTTCGAGAGGACGAGGAGGCAGGAGAAGAAGGAGGGAGACGACGGGATGGAGGTGTCGCTCGTCAAGTT
CTCGGTGGTTGTGGCGTTTGGAGACGACGATTTGTCGCCCAGGGAGCTGGTGTACTTTGAAATGGCGTGCGAACATCCGTATCCCAGGAGTTACTACGAG
GATCAACATCGTTCAGTGCTATCGGATGAAGAAGAGAAAGAGGAGGGAGGAGGTGACGACAGAGAGAGCGAGAAGGAGGAGAAAGAGCAGGTGGAAGAGA
AGAGCAGCGACGACGAGACGTTTGGGGAGGAACAGCGCGACTTTCGTTTTGATAACGATGTGCTGGCTGATTTGGCCGAGTGGATGCAGTCGGGCAAGGA
CGAGCTGGATCCCGTTGACGTCGTTGGTTTCTTCATGGCATTGCCGGTGCATGAGGACGAGTGGCTGATCGACGAACGCGTGTGTGCGATTCTGTTTCAA
GGTGGAACGGAAGGCGACGGCAGTGATGAAAGTGGCAGTGAGACCGAGGAAGGGAACAGAGTTGATGCGGTGGGACGGATGGGATTGTAGACTCGGAGGA
AGACCTAAGAGGGGCTGCTTGTCTCCGCTGTGACTAGTACTTTGCTTGACTTCAAGGCCAGATGCTCGTGTGTGCCCGGGTGTGTCTGTTTGTCGTGCCC
GAGTCCTTTCATTGCTGCGTGCCTGTGTGCTTCTCTAGGCACCGAGACTATGAATACTGCGCTAGGAAGCTAAGCTTCACAGAAACTAAAGACAGTCACC
TCATCAGCATGCATCAACATCGACTACCTGCACGAGATGATCCATTCGGTCATGACTGAAACCATGAGATTGCAAGATCGACAGCTAAAGCAAATCAAGG
ACAGCCAGAAGGACGGATAGGTCGCACGGTCCAAGTAAGTCCTCGGCCGCAATGTATAGATTGATGTCGGGTATTGACGTATCTGGGTTCGACTCGAACC
GTTGCTGGCAAAGATTCGAGAGTGGAATTGGCGAGGGCAAATGCAGCTACGGAGTGTTTTGGAGACCGACAATCGTTAAGCGTGCGATTGCACAATACGT
GTCGTGGGTCAGTGAGTGAGTGAAGCATTTTACGCGCCGACTGTGTCTACTTGAATCCGTACAGCGAGTACCTCTACCTTTTTTGAATACCACAACAGCT
CAGTGCTGTACGGTTACGTAGTGTTGACGTCCAGAATGTGCTCCTAACCTAGCTATAAGTGTCTCATAACTCGAGCAGCATACTAGACTGATACCGCACA
GCTCTGTCTCGCTCCGAGCGTCTCCGTTGCTCAAGAAAAAGCACGTCGAGGGCAATCGCATT