Description :
From Genome Similarity Track
Location :
contig_61:46222- 47381
Transcript NameFunction/comments
g11329.t1hypothetical protein

Sequence
1159 bases(100 bases per row)
CCAAGCGACTGAGCGACGCAGCGGATATCAAGAAGCACGTGTGGTTTGAAAACGTAGACTGGGACGTCGTCCCGCTCCGACAAGTGGCTGCGCCGTACGT
CCCGAGACTGGCCTGTGCAGGCGACACGACCAACTTCGACGAGTACCCGAGCTCATGCGAGGAGACCCCACCGCTCGATAACGACCCCTCTCGACAAGAG
TTCCGCAACTTCTGACACGCAGCCCGCTACGACGGACATCCAAATCGCCACAACAATCACGCCAAGGTGGCAATCATGGCGAGGGAGTCCAACGAGCCAG
ACGTGCTTCACCGATTACCAGACGCTCAATAATTCGTCCTGGTACGGAGCGGCAGATGGCACCGCAGCGTCGTGAACGTTTTACGGTGAAAGTGCTGCAT
ACGCGTCACATGGCGACCGTATGAACTCGACGAACAGAAGCAGCTCCTGCCACTTTGCGCCGTCTGCAGAACACTTCAACAAGGGCGATACAGCGCGCTC
ATGGATTTTCAAACGGCTGCAACATACGATCGTTCACTGCAGCTTGGTACGATGAGAGTCGGGGCTGCCAGCACTTCTATCACCCCCTACTGTTTCCAAG
CAAGCGGTATGGATGGCCACCTCGGTATTCAAACACTCGACGCAATCTACCGGAGCAGCGGGATCTGTAGACAACCAGCAGTGGAGCAACGACAGATATT
ATACATACCAGCAGCGAAAACTCAATAAAGTCGACTTCCATGGTGGCCGAAATGGCTGGGGAAAGGCGAGACAGGGTTTGTTTCGGCTGTCCTTCTCCGC
TGTTTCGGTTTCACTATAGCTGCTCGCATCGTGAGTGCTTTGCCGCCACCTCGGGCCTCTTCACTCGAGAATCGAGACTGGAGCGTTCACGTCCACGGTG
ATTCGTGGCCCGAGCGTCCGAGGAGAAGCCGAGAAGAAGTGCAGGAGCTGCAGCGTGCAGAGACCGGCAGCGAGCGATACAAAGCCACAAGCGGCTTACT
CAGCGCGTCAAACATGGCCAAAGACAACCACAGTCCGTCCCTGGACCCGCTGCACTCTCCAGGAAGCGACACACCGCAGCAGCAACAGTCTCCGGTACGC
AGCACCTGGAGCAGAGCACAAGACGCCGCCAAACAGAATCAGGTTAAGCAGGACACAGC