Description :
From Genome Similarity Track
Location :
Scaffold_473:4621- 7449
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_473-snap-gene-0.4Microtubule-associated protein

Sequence
2828 bases(100 bases per row)
ACCGCAATATTCTCCTCATTGGCACGTCGGGCAGCAGCATTCATCAGATTTCGTCGCTGGACGGGTCCGTCATCACGCCCCGCACACCCGACGGCACGGA
CGTGTCGAATATCGAGAACCACTTCCGCAAAGAGCTGCATGGACTTAGTGTCTGTCCGTCCAAAGAGCGGTTCTGCACGACCGGCGACGACGGAGTCCTG
CGTATCTGGGATCTGCTTCGACACGCTCAGGTGCTCGCAAAAGATCTCGACACGAGCAGCCGTGCATGCGCGTACTCCTACGACGGGGACTCCATCGCAG
TGGGACTCGGAAGTGGCGGCACGGGCAAACGGCACAAGAGAGATGGGAGTCTGCTGGTGTTTGAAGAGCGGATCATGAGCGTCGAGCTGGTCTACGAGAC
ACGTGACACGAAACAGTCCATCTCGGTGATCAAGTACTCACCCGACGGCCAGTCGCTCGTGGTGGGCTCGCTCGACAACTCGATCTACATCTACGACATA
CCGGGCAACTACACCAAGCGCGCCGTGTTCAACAAGCACAAGAGCTTCATCACACATCTCGACATCTCGAGCGACTCGCAGTACATTCGCAGCAACTGCG
GCGGCTTTGAGTTGCTCTTCGCCGACATCACGACGGGCTCGCACGTCGCGAGCGCCACCGCACTGCGCAATCAGAAGTGGGAGACGTGCACCACCGTGTA
CAACTGGTTCAACCAGGGCATATGGCCTGCGACTGCGGCTGCGAGTGCCATTCAGATCACGACGTGCTCAGCGTCGCTCCCAGGTACTTCACCGGAGATC
GCTGACGCGGTTGTCGTGGCTGGGACGTCCCACGGCGCGCTGAACCTGTTCAGATACCCATGTTTTGTGAAAGGTGCGGGCTGCAAGACGTACTTTGGGC
ACAGCGGCGAGGTCGCGCGCGTCGAGTTCTCGGGCAAAAACGGTGGCGCGCACTGTATCAGTATTGGCCAAAGCGACCGTTGCGTCTTCCAGTGGCGCAA
GACACGCGCCAAAAACAGTAGTGAAGAAGGAGATGTGCTTCTTGGGAGCGTTGGTAACGCTATCTTGCTGAAGGACCCGGAGGAGGACGTGGACATCACG
ACTGAGGGGCTCTTCCTCCCCGAGTCGTTCATCAACATCCCGCAGGAAGAGATCAAGCCGTACCTGAGCGCGATCATCCCGCCGTCATCCGACATCAAGG
AGCCAACCGAGGAAGACGGTGCCGCGGGCAAGACCGCGTTCGAACTCGAACACGTGTTCGGGTTCCGCGCCTACGACGTGCGCAACAATGTGGTTTATTC
CAAGACCAAGCACGTCATTTACCACACGGGCTGCATCGGCGTACACTACGACCGGCGCACGCACACGCAAAAGTTCTACCGGCACCACTCGAGGCCGATC
GTGAGTCTCGCAGCCTCTAAAGACGGGAGCTTCATCGCGACGGGAGAGATTTGCAGCGAGAATCTGCAGCAAGAGCGACCGCGGATCCACATTTGGGAGC
CCACTTCCTGCGCCAAAGTGACGATCCTGAGCGAGTTCCACACCAAGGCAGTGAGCTACATGGGCTTCAGCTCGAATGGTCGCATGCTCGCGTCCATCGG
TCAGGACGAGCACCACTCGCTCGCGGTTTACGCCTCGGCAAGCGGTCTCTGGTTCGACGGTGCGTTGCTGGCGACCACCAAGACCACGCGCCACGAAGTG
TTCTTCGTCACGTTCATCGACGACCCGGCGTTGTCCTACCACTTGGTCTCCGGTGGGCGGGACCATGTGCTCTTCTGGAAGATCGACGCGCCGAGCCTCG
TAGGCACATACGGTGTTTTTGGCGCGAAAGCACAGCTGCAGCCGGTCCTCTGCGGCGCGTCGATCGGGAACCTCGTGGTCACTGGGTGCTCGACCGGCCA
TCTTTACGTGTGGGAGTCCTGCGCGGTCTCGAGGGCGATCCCCGCGCACAATGGCGCAGTGTACGCGGTCCACGCCACGAGAGACGGCTACGTGAGTGGT
GGAAGAGACGGCCACGTGAAGCTCTGGTCGAAAGCCGTCACGCCACTAGCAGACTTTGATATGGACGAAGTCAAGCCTGCAAGTCAGAACGCATTCGTGC
GATCCGTGTGCTGGGACGTCGCCGAGGATCGCGTGCTCATCGGCACAAAGGGCGGCGAGATCCACGAACTCTCGCGGCTCACGGGCGAGACGAGCCTGGT
GACCGAGAGCCACTTTGGCCGCTCGGGGCTTTACGGTCTCAGCGCGCATCCCCAGACACCTGAGCTCGTGGCGACCGTCAGCGAAGACCACACGGCGCGT
GTTTGGGACCTCAATCGACGCCAAGTTGTAGCAAAAGCGACACTCGACGGATCTCTACGATGTGTCTCGTACTCTCCAGATGGGAGGTGGCTCGCCGCTG
GATTCGGAGACAGTGGAGGCAACAACAGTGGCTCAGGAAGTCCCAGCAAGAGCGGCGCTTTCGTGGTCATGGACGCGCTCACCCTCGAGGTGCTCCACGA
AGGTCGCGACTGCAAACAGAGTATCGCGGACATCAAGTTCTCGCCCGACCTGACGCTGCTCGCGCTCGGCTCGATCGACCACTGCGTGTATTTTTACTCG
ACGCTCGACAATTTCTCGCTGCGTTTCAAGTTCCCCAAGGCAAACGGCCGGATCACGCATCTGGACTTCGCGGCCGACAGCAGCGCGCTGCGCATCAACA
GCGAGGCGTGGGAGTTGCTCTTCGTAAGCACGCTTGATGGTAGCCAGGTCACGACGCCGTCGAGCATGAAGGATGTCGAGTGGGCCACGCAGTCGTGCGT
GTTCTCGTGGCCGTCGCAGGGCATCTGG