Description :
From Genome Similarity Track
Location :
Scaffold_1741:4621- 6956
Transcript NameFunction/comments
Phypl_g14055protein kinase, putative

Sequence
2335 bases(100 bases per row)
CACGTCCTGCAACAGCTGCGTGGCCGACGCGGTGGGCGAGTGCAGCTATGTGTGCTACAATATCTACCGTGACGAGCCTGCGGATATGtcgttcttcgtc
ttcttcatcacctACGGCACGTAccagagcgaggaggagctggcagccAGAGCTCAAGACTCCGCGTACGACGCGACTCTGCAGAACCTCCCGGACAACA
CGAGCACCTACGCCTGGGCGAGTAACAACATCATTACGCGGATCGGCACTCTGGACTTGCCGTCCGCTACAGAATCAGTGTAGGTGTCGGGACAGTACTG
TAGGAACTTGTTATCCGGGGTTGTTGACTGACCACCTCTCTTGCGACGGACACTATAGCGTCCTGGCCGGAGGAACCAATTTCGACTACACATTGAAGTC
CAAGGTAGTAAATCTGCAACTCGCAGACGATCTGCTCACGTCGCAGACGCAAGTGACCCAGGTTTCGCTGCTCTGCATTAACCTGAAAGGGCAGATTGGC
ACCATCCGGGACCTCCTCCCTTTCTCGACCACGTACCTGAACCTCGCGAATACGCTGCTTAACGAGTTTCCGACGGAGTTGCTTTCGCTACCATCGATAT
CCCAGCTGTACGTATGGCGATTTACGCTAAAGCACTTTCGTTTCGTGTTCGGGGTGCCCGCCTTATTCTTGATTTGATTTTCCACGCAGGTATCTCAAGA
TGAATTACATCACGGTAGTGAACTCCTCCATCAGTTCCACCAAGCTCATCAATCTGTGCGTGATATTCGCTGCTATTCCTCAATGTGTTGTTGATTTATA
ATGCGTGGTTTATTAAAGTGGGCTATCGGTAAATGCCATGACATCCTTCGAGGGTGACTTCCCCAACCTTGCTGTTCTGTAAGTGCTAAGATCTTTTAGC
TATTTGAAGTGGGTACCTAACGTTTATTGTTTTTTCGCGGTGTACTCTAACGACTTCTTAGTGAGCTCGACAAGAACAACTTCACCGAGATCCCCGCTGT
CATTTTTACAATGacgtcgttgaagtcgctgTACCTCGCAGGAAACCCTTTGAAGACACCGACATTTACAGAAGATCAAGTAAATTTCCTCATGGGCCTC
ACAGATTTTGACCTGACTGCAGCTGATTTTCAGGAGGAGGTCAACTGTGAGACGTCTGCACAGGTCACCTTTGAAGGGCTCACGGTGTGCATCAGCGACC
GCATGGTGAGTTCGAGCTCGGCAAGTTCTGCTACGAGCGATAACGGACCAGGATCAAAGTCGAACTCCAACACGGTGATGATGGTGGCTGTGGCCGTTGG
CGGTGTTGTCTTGCTCGCCATCATCGGAGCAATCGTGTATTGCCGGAAAGCGCGCAGTGCAGGCAAACCCGAGACTATGGTCATTACAGACCCCACTGTG
CGCACCACTCGAGACAATTACGACAACTTGTCGATTTGGCGCGATCCCGAACTGCTCTCGCTCCAGGTGAGTGTTGAGGATATCCAGGATATCAGGTTGG
TCGGGAGTGGTGCGTTTGGTGTTGTTTGGCTTGTCCGCTACCGCAGCGCTCAACTTCTTGCTTCGAAGCGACTTCGTGAGGATATGGCGACGCGTGAACG
GGTGCAAGACTTTGTTGACGAGATCAAGATGGTTTCGAAATTTGATCATCCGAATATTGCCAAGTTCGTcggagcagcttggagcaTCGAGTCGGACCTC
CAAGCGTTATTTGAGTACATGGAGAATGGCGACTTGCGCACGTATCTGTCGGCTTCCTATATGCCGCGCTACTGGACGTCTACGAAATTTCAGTTGGCGA
TTGATACGATTGAGGCACTCGTTTACGTGCATTCGTTCGATCCTCCGCTGGTCCATCGCGATCTGAAGTCACGAAATGTACTGATATCGGCAGAGATGCA
AGCCAAGTTGACAGACTTCGGTACGACACGCTACCGATCGAAGGATGGTACAATGACGATAGGAGTGGGAACTGGTCGGTGGGTGGCGCCAGAGGTCATT
TCAGGGAGCACTGAGTACGACCAGAGCGCAGATATCTTCTCCTTTGGGGTGCTTCTGACTGAGATCGATACGCATAACCTCCCTTACTACGACGCCGTTG
GACCAAGGGGTAACAAGTTGGAAGAGGTAGCAGTGCTTCAAATGGTGGCAAACGGCCAGTTGCGTCCGACGATCAGTCCGTCGTGCCCACCGACTATACG
AGACCTTGCTATCCTCTGTATGTCCCAAAACCCATGCGACCGTCCCGTTGCAGCGGAGATTGGGTACGTGCTGCGAACAGTGCAAAAGGAGATGAGTAGT
GTGTGAGGTATTGCATTCGAATCTTGTGAGCGGTT