Description :
From Genome Similarity Track
Location :
scaffold_10:46206- 49052
Transcript NameFunction/comments
g643.t1hypothetical protein

Sequence
2846 bases(100 bases per row)
AATAAATTAATTTTATAAACACACTTATTGTCCAACTGGACGTACTTAGACGTCCACCTGATCTTCATGGTTGCTGGGATGATACTGCGCATTTGAGAAA
TCAGGAGACGACACCACCATGGGGTATTCTGGAGGTTGGAAGGCAAAGGTGCCGTGAAGGTGTTGCGGAATCGCCTCCATGGCCGGAGGAGCCAGCAACG
GAGGCCCGAATGGCATCGATGGACCCGGGTTGAAGTAGTATCGCGACGGCGGAAGACCTGCTGAAGGCGGCAGAAACTGCGGCGCTTGAAATCTCGAGTA
CGCGTCGCCATTTCCGGGCGAAAAATAACGGACCACTTCTTTTGGTGCCGTTTTCCATAACATCGACTCACTCCAGGGAAGGTTGGCACCAGAGCCTGGT
AGTTCGCACTGCCTTGAAAAGTCCCAGCCAAAGAGCGACGAGGTGGACGCGTATACCTGTTGTAGCTTCCACTCCAGCTCGGCGTCTTCTTCATGTCTAC
GCTGCTTCCTCCGCCACCGCTGCGAATCTCCATAGTCGACTACATCGTCTCTATCCAAGAAGTCACCGTCGCAGCTTTGGGTTTCGAACGCACTGCCAGC
CTCGCTCTCGACATCTTCCCACGGAACACTGACAATGTACTCGTCAAACTTCCGCTTGCCTGCAAATGGATTTCTTGAGTCCACACTTTCGATCACATGC
TCTTGAGGCTGGAATACTACAGCGTTGGGGTTTAAACCCGCCGATTTCTTCGAGAACGGCTCAACTGCTGGGGACACGTCTTCGTCTTCTTCCACAACGA
TTTCATCCCTTTGAGCTGTTGATGAATTTGACTGACAGTCGCTGTCTATAGACTTGTGCTCAGGCGTTGGTTCAGGTGCTGGCTCATCCATAACATCGTC
ACTTGAATCTCCTAGTGCTTCAGTTCCATCAGCACTATTCACCACCAATTCACCCCTGACTTGGTCTCTGGAATGCAGCGATAAATGTCCTGCTGATTTC
CTCTTCCTCTTTTTCTTCTTGCTCTTCTTCTTGTTGGAGGTGGCCGATGCGCTATGTTCCTTTGCCTTATCCTCCAGCGACACTTCCAGCAACAATTGCT
CCATTTGCTGCGCTGCTTCTTTTTCCAAATGGATGACGTAACTTCGTAGGATGAGCTAGATTACACATAACCAGTGTTAGAACGAGTGTCAGCTTCGATT
TCACATAGGCCAGTAGCTCGTACTTGTTCCACCAGCATCGCGATCAGGCGTTGATAGTTTGCCCACGTGTTAATGGTCTCGCTTTCCGCCACGAAGAGTT
TGTTGAAGTTACTCTCCGTGAGCACGTGAATGGATGTCAAGAATCCCTCTAATACATCTCCTACCAGTGTAAACAACCGATCGGTGTCTTCCGCCAGCTC
TGTTTTTACAGTCAAAATACCTGCACAACAACGAAAAGAGAGCGACAAGCTTAGAAAAATACCACCAAGAGCTACATCCTCGTAGTGTACGCACCTGTGC
CAATATCCATAAACTCCATTGCCTCAAGTAGCTCGTACGTTTTTTCCGAAGAGGTGTCTGTCGCCGAACGCGTGGATGGCAGTGACGTTGCTCGCTCTAG
CCCTGTCGGCGATGTGGTAGATGCAACCTTTGATGCTGCCGTCGTTGCTGTCGTGGCGACCTCTTTTTTACTATTAGTTGCTGTGTCAGTAGCTGCTCGA
TTGGAAGTCTTGAGGTGACGCTGCATGAGTCCGACACACAACAAACTCAGGTTGAGCTTGTACAGCTGCTTCACAAGCTCCGGTTCGTCCAGGAACAGTA
TTTGCTGCCGCTCATTGACGCTGAGCTGCTCCCAATAGTGACGGACACTCTGTAGCACAGCAACAACATCCTCTCCACCACCGTGTCGAGTCGTCGTCAC
TAGGGGTGTAGCCAGCGTCATCCAGACTCCAGCTCCTGGTCCATGCATTCCACCTCGACTGGTCAACGGTTTTGGTCTTTTACGACCACGTGGATATATA
TTGGTGCTAGTGTTGCTCAGTTGATCCGCTGCGTTGATGGCATTGGCACCACTGGTGGAAGAACGAATGGCCAAGTACAATTTCCAGATCGGAGCTGTAT
TAATAAACGGTTAGCACGGCGATCAATTAACGCGGCCGATGCAGCCATGGTCACGCACCTTCTGCAGCCGACGCGGCCTTCTTCGCGGTGGAGCCGCCCC
GAGACAGCGACGTCATCTCGACAATTCCTTTGATCCTTTTGCGACCACCCGAAAAACTCATAGTTCTTGTGTTTTAACACAATTACATTGGTATACTATA
GTTTTAAAACAGAGACAGCCATTTTTGCATTTGAGACCATGGCAGACATCCAGCACAAGCGCGTGGCGCTCAAGCTGAAGCAGGCATGCGAGGAGACAGC
GGCGCAGGCCATCGCGGCCACTACCGCCAGTGGCCAGGCGAGTCGCATTCACGGCAAGAACCGCAAGTTCGGCAGCCGGAAAGAGGCGATGGCCGCAAAA
GTGAGTTCAGAAGAGAAAATGCTGGAAAATAGTTATTGACTGACGTATTGTTGCAGATTGCAGCAGCAAAAGCGAAACGAGAAGCAAAAGAAGCTGCAGA
GAAATAAGCCGAAACCTTGTCTTAGGTTGCTAACGATGCAGATTCCTTTGACAGCATCTTGTGTTCGATTCCACCCATTTCTTTGGCTCGTTCTGCGCAG
CTTGTAGCAACGGAGAGGGAACGATGGCACTGACGAGCTCTAGTGGCAACCCACCGGACTGGACGGTTGTGATACGAGATCCATTCGCGGCGTGGAGTGA
AACCTGTTTTGCCTTTTTTCTTTGTAGCGCTGAAGACTTCCGAGTC