Description :
From Genome Similarity Track
Location :
Scaffold_401:4620- 7856
Transcript NameFunction/comments
Phyag_g5389hypothetical protein PITG_13610
Phyag_g5390hypothetical protein

Sequence
3236 bases(100 bases per row)
CGGAGCTTGGCGGGATGGCTGGTGCAGCCCTTGGCCAGTTCGAAAGTGGCGCCTCGCGGGCTGCAGTGATCCTTTGCTGTCACACGCCTCTGCTCGACGG
TTGATTTTGGTTTCATGAGATTTTCCACTCCGTTTCGTCGGTGCTTTTTGTGCCGCAGGCCAGTATTTAGTTCCTCgtggccacgagcagcagtgtGAAC
ACGTCGCCGAAGAACGTGacggcggcgatgcagcCGTAGAGCAGTCCGGATGACGCCAAAATGTACAAGACAGCAAGGATGGCCTTGCGCGTCGAGGACG
CAGTTTGCTCCGTTACGAGTTTGTCCGTCGTGTCGTTGTCTTTGGAGGGGAAGACGACCACTACCACGTCGTCCGAAGCCGTCAAAGGAGTCACTTGAGC
CATGGtagctggtggtgctgagctTTACACTTGTGCTGAAGCGGGGGAATTCGATAGTGATGGATAGAGGGACCTGGTCGGTCTCAACGGCGGAAGGCAC
CGCAAATCCTTAGACAGGCGATGATCCCTACGGCACTAATATTGTCCACCAGAACGGGCATAAACTGAGGAGCAGATAGCCTTTTGTGACGCACGGAGTC
CATGTGGCACTCGTGACCATTTGGTGAGTGTTCACCATTCGCTCATCGCAGAGTGAACAAGACTCTAAAATCTAATGCTTGACGTATTCGTGTTATCATA
CATAGTCATCGATTTACACTGCACTACCTAGGACAGCAGGTTTGGGTACAGGAAGCGAGCGTCCGAGAGGAGGTCAGGCATTGTCGAGTGCTTGATCGGT
GACGCTACGTTGGAAGgggacgatggagaagcgtcGTCCGTTTtactcgctgctgttcggcgACGGAACTGCTtgtggaggtgctggaactgctgccgAG
CGCGGAAGGCGttggcctccatctgctgcatTGCATACAATTCCTGGATCTGCACAGCGTAGCtggcgtggagctgctgcagtttggccgcgagctgctt
cttaTGGCgccgcttgagctgcttccgTTTGAGGTAGTCGTGCGCCACGCCGCGTCGCCAATTCATGCCACTGGACGATGACTTTTTCGAGTGCGAGTGC
GACGCACAGCTGCAGTCCGGGTGGTTGTAGATGCGCTCGCGCTCGGCCAGGAAGTTCATCTTCAGCCTCTCGTTCTGGTGcgaaaactgcagcagcaggt
tggTCTGCTCGgtagtcgcagcagcacggtcAGCCTCGATATCCTCGTCTGTGTCGGCCATGGTGATGTCACCGCTCTTTGCAGCGTACTGGTACATGGT
CGCAGCCAGAAGGGAGCCCTTGTCGCTCACGAACGGCACCGACACGAACTCAGGTTCGTActgctccagttgctccagctcctcgtccagctcagcatcc
tcttcttcagcaggaGTCGCAGGCTCCACTTGGTTGCTCACCTCTGCTGGCTTCGTCGGCGGGGTAGCAACAACAGTCTCTTTTTCCGACTTCTTCAATC
CCGCGCGGCCTCGCTTGTTAGACGTTTTAGCTGCCACagtcttcttcgccgacacTGAGTCCTTCTTGGTATCCTTCTCAGCCACATCGGAGTTCGCCTT
GTTGGCACTGACCTCGGGGGTCTCGTTGTCAAGGAACAAAGCTTGAGCCTTCATTCGAAGAGCAATCTTCTTTTCGTTAGACGCATTCTTCGACTTTCCC
TCCGCTTGGTTACTCGAGATTAGCTGAGCCAAGACTGCCGCCGCATCAACAGCGGAATCGGTgagttcttcctggttgccTGCTCGAgtctttgctgctg
tagcGGGGGGTGGAGTCCACTGAAGCTCCTTCAATGCCAGCAGCTGTCTCTCTACTCTAGACAACCCGGGTTGTTCCGGAGTGTTGGGGTTTGACGACCC
AGACGAGGACGAAATCGACACAACAGGAGATGCTGCGCTAGTCGACACCTTGTCTCCAGTCCGGTTCTTGCCGCGCTTGGGAGTGGTTAACGCTGCACTG
CTGACACTGACCTGATCATCAGCCGCATCGAGTTGCTTGGGCTTAACGGACTTCTTCTGGGATCCACTCTTGCCAGACAGCACCTTTCGTTTGTCCCCCG
ACTCAACAATAGTCTTCGCTTGGGAGGTGACTTTCTTCTCACTCTCAGTCCGGCCCCGCTTTACCTTGCGTCCTGCCTCCTGAGTTTTTGCCGACGTTTC
TTGACGACTCCGCTTGTGATTCGCCTTATCCTGCTTTTTGAGTCGCTGGTGTTTCTCTTTCACGGAAGTTTTGTTCTCACCGTCGgagtcactgctgctg
tcactgtcGTCTGAACTGCTCTCAGCTCCACCAAGGTCTCGCACAACGTTTTGCAGATCACTCTTCACCTGCGAGTATTCCTTCTTTTGCTGGTTGCGGT
GCAAAAAGGCCTGCAGGCTGCGCACGAGAAGCTGGTCTTGGTTGGCGGCGATCACCATCcatttctccttctccgtctcggGAAGAGGTAGAACCGCAAG
AAGTCCACTCGTGTTGACTCGGGTAAGATCCGAGAATTGCGCTTGAAAGTCCAAGGACGGGTCCACGAAAAACTGCTCGTAGCCTTCGATGTAGTCGAGA
GGCGTCGCGATTCCTGTCTCCTTTTTCGGCTGGTGGAAGAAcacgctgccgtcgctgcacATGCCCACAGTGAATGGCGACGCATCTTGACCAGCGACCT
TGCTCACAGTTCGCATGTGACGCTGCCCACTCGTGTCCTCAGCGCCTCGTCGACGGCTTCCGCGGGGATTCCAAGCACGCAACGAACTCGCGTTTCTGGA
GGTGATGGCGGCTTCACGCTGAGCACGCTGCTCCTTTGCCGACAGCGGCAGATCCAAATCCATACGGCTAGCCGACTGAAGATCCACAACGGCGAGCGAC
TCGTTTCCACCGTAGGCGTAATCTCCGTACACAGCGACCGTATCAACGGTCTGCTTGACATCGATATGTGACTTCTTACGAATCTCCACCGAGTCATCCG
AAGTATCGTAATCCTCTTCCAGGTGCCAAATGCGCACGTTTTGGTGCTCGGACTTGGAGATGAACTGGTTGGCATTCGTCGGGTGAAACGTGATGAACTC
CAGCGAAATGCCGTTGGTCTGTTTGTCGAAGACGCACTCCCAACTCCACTCCAATCCTGCTATAGTCTTCTTCTGGTAAAATCGCCACATGTGCACGTTC
TTGATGCCGATGCCACACAACAAACGGTACTCAGTC