Description :
From Genome Similarity Track
Location :
scaffold_23:461985- 464325
Sequence
2340 bases(100 bases per row)
GCGGAAATATTTGACGAGATGACACGTGAGAAATAGTTTAATGAGCAGTCGCGGGACGCAATAAGGTCAAATTTCGTGTATGGATATGTCAAGGAATAAA
TTGTTATATTCTTAGACAAGGTGCCCGACGAATTGCCATCTGACAGAGGTATTCGTCACGGGAAAAATGTATACCTCCGAGAACGAAGAACTGTATCTCA
AGGCAATGGCCGCTGTCAAAACAACAAGTCATTGCGATCGACGAGCTTTCTTTGCAGCGACAGATGGCTGGTCGTGTGCTCAACGTAAGCCTCTGCATTA
TAGCCCCACCTTCTGTGTCGTACAGGCAACAAGTAAATGCCACATTGTCTATGCTTTCGATAAGTTAGATGATGCAATCACACCAGCTCAGACTCCGGCA
TCACGCAAGGAAGTAATCCTTGATGATATGATTGATAGTATCTTTTAATGCGATCTACCTGAACGATGGTCTCTATCTGGTACGTGTTGCCACAAGGTTT
GAAAGCTCCCATGAATTTCGACAGAATGGTCACAAATATTCTGCGTCCATTTAAAGAGTTTGCACAGGGCTACTTTAATGATATGTTTCTTCATAGTAAG
AGAACAGGTTAGAAGTCTGATGTCGATGTTTATCTTGGTCGTCTTCGTCGAGTCTACCAAATTATGCGTGAAAATAAATTCCACAAGAGTGCATTTTCTT
CGCGCCTGAGATCCCCGTGATCGGTTGCTTTGTGGGCTAGAATAACGTTCATGTAGACCCGGAAAGGCAAAGCTATCAATAGCTCGACAATGCCAAACAA
TATGAAAAGCTGATGTGATTGGCTAGGCTCGGCCAACTTTTTGCATGAACACACTCAGGATTATGCAGCGTTGGTGATTTTCTTAAGAAGAACGTTGAGT
GAAAATGGTCAAAATATCACCAGACAGTATCCaccagatgaagaagaacttATGAGAAGCTCTTGTCCTTCCAAATTCATACCACAACAAGTCATTCTAT
GTTGTTGCTATCGGTTGTGATATGAAGCACACGATAATAAGGGTCGAGTGCGAGTTAATTCGTATCAGTCGCGACAACTCCTGCCCGCGTAACGGAACAA
TTCATTTCATTACAAAGGGCTTCTAACGACGAAAATGATTTGATCAAATTCCGTGTGTACTTGCTTGGTGTGAAGCTATTCGCGATCTAAACAGATCATG
TCTCGCTACGTACGGCAGTAGAGACTCCTCATTTATCGCTGAGAATGGTTCAATATTTTTgtacaactttgttgtaCACTACAAGTCAGGCAAGACCAAC
ATATTAACGCGTTGTTAAGACGTCCAGGCTATGATCCAAAGTCCTGTAGCGAAAGCGTGCACGAGTCATGCCGGCAATACGAAGATGGCAAGATGACTAT
CGGGCAGGCTTCGATTACAATGCGCAGATAAGTTGCAAGCGTACAAGACTGATGCGAGATGTCAAGATATGTTGGAGAACTTCAAAAACCCTTTCGTCAA
AGTACTACGAGGCCTTCCGTCTTGCACAAGTTCGCGTGTTCATCGTTTTGGAGTGCAGAACGGATTGTTGTACTGTGCGGATGAGGAAAAAGCAAGCGTT
CTTGCTCCTAATGACGAAGATTTGCGAAATCGTCTCTTATATAAGTTCCATGACTGCCTTCGAGTGGCCTTCTTGGAAGCTAGAAGACGTTAATCAGTCA
TTCCCGGGGAAACTGTTCGCCACACATGTATAAGTATGTGAGTGAGTATGCGAGGATTAGCAAGATTTGCCAGAAAGTGAAACCATCGGGTAACGTAGGA
CCCACTTCGGTCATTGGCACTGCCAACTGGCAGCTGGAAGTCTTTGACTATGGTGTCATATTTGGAATTGCGTGCGAGATACATGGACATAGTGACATTC
CTTTGTGAGTGGACCGTTTGGCACaatggttcatcttgcgctTGTTTGGATAAGATCTCTGCCGATAAAACAGCTAAGATCTATGTAGATGTTGTTTTTC
GTTTGCATTGCTTTTTATCTCGTTTCTTACCGTGATACCCGTTTCACGTCGAAGTTCTGGTTTGCACTGTTAGGACTATTGGGCACCAAATTATGCATGT
CAACTGCGGCACATCCTAAAATGGACGGTCAAAAACGGAAAGTGTGAAATGTATCCGGGGGTCGTAGCGCGCAGTCACACTACGTCGTTCAATGCGTTGA
GTGAATTTACGCCAATCACAGAGTTCGCGCTAAGCCACTCCATCATGTCTCGACAGGTCACTCGCCGTTTTATGTGAGCTATGGTATCATCTTAGAGTAC
CTTCTTCAATAATGGGTGAGGTCTCTACCTTAAGTCGGGG