Description :
From Genome Similarity Track
Location :
scaffold_11:46193- 49745
Transcript NameFunction/comments
Pl_112501conserved hypothetical protein
Pl_112502manganese superoxide dismutase
Pl_112503H/ACA ribonucleoprotein complex non-core subunit NAF1, putative

Sequence
3552 bases(100 bases per row)
ATGCATTGTGGTGTTTGAATCTTAAACATGCAACAGCGGCTAGCCAAAACACGCCAATTAATGAGATGAATGGCGCTACCAGTATGAAATAGAGCATATA
ATATATGCTGGTTTTAGCTGAACAATTATCCAGTCCTTCCGAATGGTTGAGGTGTTCCCGATGGATCGAATAAACTTAACTGACCAAGTTCCTTATTAAA
CACCTCTAACTTTGAAACGGGTACGAACACAAGTTCAAAGTTGGGCCAAACATGGTTTAGTTTAGCTTTCAAAGTGTGAGTATAATCCTTAGACATTTGA
TTTATACGAAACCTTGATATTCTTTATGATTTTGCGCGAGTTTGAGATGTGTATGGTGCATGCAAATGCCAGCTAGTGCCAGTTCGATCGATCTCACCCC
GACGCACTGATTTCGAATCTTTAATCCCTTGATCTCTACACCACCGAAGTTGTTCGGACGCACCTTAGAGTAAAGAGACAACGTCCCAACCAACATAGTC
GAAGTGTTAACCCTCTTAAACACTAATTAACCCGTCCCAGGAATTCAGGTTGAAGTGATAATGTACAACTCAAAGTTCGATCTGGTCCAGGTTTGGACAT
TCTTTTTGGGAGATTTTTACCTGGTCAAACCTGCAATCTCCTGCTTTAGGTTCTCGTTCTAAAGCTTCCAGTTAATTTAAAAATGAGTGGGCTGCCTTGA
TCTCAATCTTCATGTTTGCACGAATGCTGCAAAAATTCACAGCTCGAAAAATGAATATTTTCAAGTGACACATAATAGCTAAATCAAGATCCATTCAACA
CGATCAAGTTGATGGGCCAAGCGTCGCACGAACTCACTTAAGGGAATGTCTCCATCCAAACCGCAAGCGTCCTTCTTCTGGGTGAAATATGGCTTCGGTA
TGTTGCTTCCCTCTATGTGACTTGGCACCTTATCTTGAAAATGTGTTGTGTACAGATACAATAACACAACCCAAGATGTACAATTCCAATGTTTCCTGTG
CAATCCTGCGGAGTTTCGTTAAAAATACTTGCGCGAGGGACGTGGAGGATCTGTGCAAGCAGAAAAACATTCAGCTGGGTATTGAGCTGGACGCACTCAA
CAAAATTCTCCAGACTGCCCAGGGTCACAGTGCAGCAACACCGTTGACGACAAATCTGTCGATAAAATCTGGAGGTGCTGGTTCGCGTCCACCAAGTGGA
GCCGCTTCATCTCGTCCAATTACACCCACAGTACACGCAGGCGCTAGTGATTCAATCGATGACGAATTAGCAGATGTCGTTGCCACGAAAACTGCAACTG
AGAACCAACTCAAAGTGGTTGCTACAGCTTCCAAGCTCGTGAAAGGTTGCAACTTCACTAACGTTGCGTGGGTCGTTGCTGACTTTTGTTGTGGCAGAAT
TGATTGCAGATACAGCTTTCGTTGATCTTGTCGATGATCACGGCAATAGATTGAAGCTGGATGAGCATGGCGATGCACGGGCAAACACAATCCTGAAATC
TCGAGCACAATACACTGCGGTGGCTGTCAGTACGTGCTTTCAAAAATCTCAAAGTTCTATCCGATAATTGAACGCGTTCGTTTTGTTCGCTATAGCTGTA
GACGACAAGGGACCACCTCATGTTGTGCCGTTACTCTTCAAGCTGCAGAAGCCATCGTTAGACCAGTCTCCTTCCCGGCCAAGCAGTGGTGCCGCCAAAT
CAACAGGAGCTGCCATATCCACATGACATGTACCAAACATTAAGCCCGTTGAATAGATTCAAAGAACTTGATTGAGATTAATTTGGGAAGAGAGCTCCGA
GGAATCGAAAGCGACTCAACGATCCTCGTGCATTAGGCCCCTTTTGCAAGAAGACTAATGATGAACAAAACACATCACAATCATAGAGATGCTACACTGC
GACTCGAGCCTTCCACTCATAGCGACGAGTGTGTCGTCGCTGCCTCTTGCTCTCCACTTCAGATGTCCACAGGCTTGCCCTTCGAGGCGAACTCGTCGTA
GTACTCAACAACCTTGTCCCAGTTAGCCACGTTCCAGAAAGCCGAAATGTACTCAGGACGGCGGTTCTGGTACTTGAGGTAGTAGGCGTGCTCCCACACA
TCCAGGCCAAGAATGGGGATGAGTGGTTGGTCCACGCCGGGCATGAGCGGGTTGTCCTGGTTGGGCGTGGACGTGATAGCCAACTTGCCGTCAGCCTTGA
CACCGAGCCAAGCCCAGCCAGAGCCGAAGCGAGACGAAGCGGCCGCATTGAACTCCTGCTTCATCTGGTCGAGCGAGCCGAAGTCCTCCTCGATGCGGGT
CTTGAGGGCGCCGTGCGGGGCCGTGTTGGTGGAGCCTGGCGACGTCATCCACGTCCAGAAGAGCGAGTGGTTGTAGTGGCCACCTCCGTTGTTGCGCACA
GGAGCCTCAGTGGCCGACTGCACCACCTCGAGGATGGATTTGCCCTTGAGCGCCGTGCCCTTGTCGGACGAGATGTAGTTGTTGATGTTGTTCACATAGG
CCTGGTGGTGCTTGGTGTGGTGGATGTTCATGGTGTCCGTGTCCACGAACGGCTCCAGCGCGTTGTACTCGTACGCGATCTTGGGCAGCTCGAACGACAT
GTTGGTTCTAGAGGGGGCTCGGTTGAAGCTTGAAGCTTGTGCTGGACCTGGCGAATTGCAGAATGAGAGAATGACGCCGACGTCAATGGGATCTTTGGTC
GGACAATCCCACCGCACACGTGATTGGCCAATCCGCTCGCCTGTAGCTCAATTTCCATAACTCAGTACTTACGAGGAGGAATTGTTTCGCCTCAGTACAG
TTTCTTGGGACAACTTGCAACTTTGACATGCAGCTTGTCGGAAACTCTGTGATGCTAAACTGCGCCAACACAGAAGGCAAACTCTGCGTTGTGCTCTTTA
GCGAGCTGAGCACTGCTATTACCATCAAGTTAACTAGAAGTACTGCCTGTCGAAAAATTAACTAAGTATCATAAAGTACTACTTTCAGTAGTAGTTCAGA
AGACAACTTCGACACTTCATTTCCAAAAGCCGTCGTCTATTGGAGCTAAGCAATCGGGGATAGCTCGAAGGCACGTAGAATTCGGAACTTATCTCACGAC
CGACCCCACGTGCTTTCACCGGCAAAGTCGAGACGAGATTGTAGTGTTCAGGAAAAAGTGACAGCAGTTATAAGTACTTCTTTACGGGAATTCCTCTGAT
GACGTAGAGGCAAGGGTAGGTCAGGCGATTACGAGACAAGCCCGTTGTCCAGTCTAGGATGTTGACTCCATGGCTGCAGGTGTTTGCAGTCACGTTCGTC
GTCGAGACCGACGAGCAATCCTTTATTCAGTGTGCACAATGCGCTGCATTGAACGCAGACAGAGTCCCGGAGGAGCTGCATGTCGAAGTTGCCGGTTGGC
TCTCCCCGAACCCGCGTTGGTTTAACGTTATTCTATTGGGTAGGTCTGTACTATTTAGTAGGTTTTTGTCACGGTCTTTTGGTTGGAGCTCCTCGACTTC
GACTTGAATCTCATTTCATCGCCGTCATGGATGCGCAGCAGAGCAACGAACC