Description :
From Genome Similarity Track
Location :
Scaffold_223:46174- 49698
Sequence
3524 bases(100 bases per row)
GCGCAGCCGATTGCAAAATCGCTGGCGTCACAGACCACATGGAATGCTCTGTCTTGGTCTGCAGTCTCCAAGATGGGCGATTATGTCAAGCTCTGCTTGA
TACCTTTAAAGGAGCGCTGACAATCAGCGTCTCATGACCACTTCCCGTTCTTTTTCTAAAGACGAGAGAGGTAAACGGTCATCTTGGCGTAGTTGCGCGA
GTACTTGTGTAAATACGCCGCTAGACTAAGGATCTTTCTTAGCCCCTTAACGTCGACTGGCACAGGCCAGTCGGTAATCGCCTTGATCTTTTCTTGATCA
TGGCGTACACCGTGTTTAACCACGATGCACCCAAGAAATAATATTTCGCTAGCGGCAAATATACACTTCTTGAGGTTGGCATACAGCTTATGCTTGCGCA
TAAGTGTAAGAACCTGACGAACGTCTGTTCTATGAACGTCTACGTCCGTCTTTCCGCCCATAGCCCGGCTATGGACGAATACATCGTCAAAGCAACTCGG
TGCAAAGTCTCGCACCGGTCTCAAGAGATCTGTGACGCATCTGTTGAAGGTGGCAGGGGCGTTACTAATTCCTTGTGGCATTACTAGCCACTCCCAGAGC
ATAACGCTCGGGGTGGTTACTGTCGTGTACGGGATGTCCCGTTCACGCATTAGGATCTGATAGAAGCCATCCATCAGATCCATGGACGAAAAGATGGTAC
TCTTTGACATACCATCAATGATTACGTCCTTCCTCGGTATCAGCGTCTGAGCCAGTACCGTTGCATCATTCAACTTATTGAATGCGTGCACTATCCGCCA
TTCTCCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGAAGTTGACTTCCTCACATGACCCGCAGCTAAGCGATCGGCAAAGAATTTGTCG
ATCGCAAGTACTTGTTCACGAGGCAGTGGCCACTACTTCATGACACAGTACTTCGAGCCCGGTTTGAGCTCGATTCCATGTCGAGTGCCTTAATCCTTAG
GCAATTCGCATGTTACGGAATCAGGGAACACGTCCTCGAATTAGATCAAATCCTTATATAAAGGATTTGACTTATGTAACTTCCAAGATTGAGACGTGTA
CCGCTCAATCCGTGTCTTCTCATCGAGGACACTTTCGCCCATCGATGAGATGCTGAGAACCCGTTCGTTCTCGGCAGATATACTCCCGACCTAATTTCAG
TCACGAACTCGTCCTCCGTGACGAGTACACAGATCTGCTTGACCTTTCCACTACGCAGATCTCGCAAGAACCGTTTCGGTTCTAGCGTTGAAAATTGAGT
GATCTCCGAAGTCAACTTCGAGGCGCGATCCGATCAAGTGTATAGGTGCCTACACTTGACCCGTCATTAACCAAGACATTCAATGTCTCGATTTCCTCCT
GTAAACCGTTTTCCACAGGCTGATGAATACTTATTCCTTCAGGATGATGAGGTCTCATTCCCTCACCAATAACTGCTTAAGCAATTCTTTCCTCAAGTAT
TTGGGGACCTATTCCCTCGACGTCTTCTAGCTGTGGTTGCGCTACCACAGCTAGGTCCTCAGCGATCGACTCTTCAGAAGATCTAGGATCATCGTGTTTC
CCTGTGTAGGCAACAATTTTATTCTTACTTGGATGTCACCCGCTAGGCGTACACCCATGTCCCGATCCACTTAACTTGTTCGAGTGGTTGACCTTCGGCG
CTGCGTGTGCATCCGCACAGCCGCCGGCAGCTTCCTGCACAGTGTGATCGGTTTTCACACTGTGATCTTGTGCAGTCGTACTAGCGACCGTACCGCAAGT
GAGGCCATCGCACTCACTTGCAGTACATCCACACGCTTGTTTACTCTCCAAGACGTTCATCAGATAGCCATCTAATGAACAACTGGCAGGCATCTTCACG
GTTCGATACTTCCAGCTGACCCTTGGCTCGTACCTTCTGATGTTATCCAAGGGTAACCCTTGGATAACATCAAATTTGTCATACAAATCAAGTACGATGA
AATCATCATTGTACTGCAAATCTTCTAACTTGTAGTGAAATACTACTACACGTTTCATCACTGCTATCGATGCGCCTGTTGCGAGGCACAACTTTAGCCT
CGTAGGAGGAGTAACGCGCTCAACGAACTTGAGCCTGCGATCCTCTAGTGACTGGCGACGAGCAAAGTTGTTCGACGCCCAACAATCAACTAAGGCACGA
AGTAACAAATCTTTTGTCACTTCTAAATTCAAGGTGATGAGGGGTACCTCATCACCAAGTTCAGAGACACACAAGGATTGTGAACCTGGAGCAACTTTCA
TCAATAGATTTGCAAATTCTATTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCTACTGACCCCTACCGTTTTTGGCGGTCCGCCACGCTGTTGTGTCT
CCGCAACAGCGTCGGACCCGCGTCCGTTGCCCTTGTTGGCAGACGGTCAATCACTTCGCTCAGTGTTTCGAGACACTGGGTGTGAAGCTCTACACTCGTA
GGCGTAGTGTCCTAACTTCTGACAGCGATTGCACTTTTGCAATCGCTTACTGCTTAAGGATAGAGGTCTCTCGCTCTCAACACGGCAGAGGTTCATTTGG
TTCTGAACCTCCCGCCTCTGATCGTCTCGAAGGACGATAAGGGGTCAAGCTAGTGTGATCCTGTCTCACACTGATTCTTCCTGCACCGCAGTTGTAATCG
CTTCCTCTAGCGACTTCAACTCGATGCGGAATAGGTTGTTCCTCACGGAACCATCTATGAGGCCCTGTAAGAATATCGTGATCAACACGAATTCACTTAC
AGAGCTCGCTACCATGCAACTTGCAAGGTAACGAACATGCTGAGCGTAAGCGTGAACGTCATGCTTACCTTGTTTTATCTTCAGGAGCTCTGAAAGAGTC
CTGAACTCAGATCTTGGCGGCTCAAACGTTTGGCTGAGCAGTCTTAAAGATCACCAACGATCCAAACGTTTGGATCGTGTAATTGAAGATTGAGGGCCCA
AGTTCTGGCACGCCCTGGAAAATTCTATCTGGCAAATGCAACTCGTCGATGTGGCAAGCCTTAATGGCGTCGTCCACTTTGAGGAACCATCTCAACATGG
AGTTTTCCTCGTCTCCCCGGTACTTGGAGACTTCTAACTTTAGAGTCTCACGTCGACGCTCACGTGTCGACGCTGCAGTAGCAGGCTGAGACTATTTTTG
CTGTCTCAGGAGCTCAGTCTGCTGGTGACCGTGCTGATACAGCAGGGTCGCTTCAGCTCGCGACGCGTCAAGTTCTCGTTGCAAGAACTTGGCTAGTATG
GAATGCTGTTGGTCCCTATCTCTTTAGTATAGCAGATACCAGCCAGCTTCTTCTCCGACGGTCGAACTAATTCGTTCGGCCGCACTCCATTCGTCGTCGC
TCAAATAGGAGTAACTTTCACGTGTGCTGTGCAAGGTGTCGTCGCCTTCGTCGTCCAACATGTTCATGTTGAACGGGTTTTGAGGTCCTTGGACGGACTA
CAAAGTGCTACCAGGTGTAACGGG