Description :
From Genome Similarity Track
Location :
Scaffold_23:46170- 48886
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_23-abinit-gene-0.112Tetratricopeptide repeat protein

Sequence
2716 bases(100 bases per row)
TCACTGCAGGCAGCTGTACGACGCGAGAAAGACAAGGACAATGGACGACGAGGACGACTTCTTCGCAGAGCTGTGTGGTGTGACGGTCACGGACATGGAG
ACGACGGCCGAAGaCGAGAaCGTCGTGCTCCAGGAAGTGTGTGTGCAGGTCGAGCGCGCGACGATCGAGACCAATGCCGAGCAGGTTGACGCGGCACTCG
AGACCAAGGTGAACGTCGATACAGCACGTCGACTTCtGAGCGCGCTGCAGCTGGGCAAGCTTGTGTGTGAGGGTCGCTACGCGGATGTTGTGCGCTCCGA
CATTGGCCAGCGTGTGGCGAAGGCCATCGAACACAACGCGGACACGGATGCCGACGTGCACATGGCAACGAcGATCGCGAAGAACCTCGAGGCGTTTGTG
CTGCAGAGTAACAACGACGACGACGAGCGTCTCGCGGCCGCCTACGAGGTACTCTTTGTTGGTATTGCGCTCTTCAACCTCTTCGTGCAGGCCAACTACA
CGGGTCCGGCGTTCGAGCAAAAGCAACTGAGTGATATCATCTCACTGGCCGCCAACGCGTTTGGCGTGACATACGAGGAAGCGAATGGCGATAAGAAGCT
GCACCGCGAGGCCATTCTCGCCCTGCAGGTGGACGGTGAAAGCCCCTTCACCATCTGTGAGTTCCCGTACTTCTTGGCACTTGGACGTGCAATGCTAAGC
TTTGTCGGCAATGCCAAGTTCCCCAACTGGTCTGTGGCTGTGGAGAAGTTTGGCACGCACGACGAGGACGAAGACATCGACCAGGCGCCTGTTGTGCAGC
CCGAGACTCTGGTGGTCCTCGAGAAGCTCCAGACTGCCGCGTGGTGGAACGCACGTGCTGCTGTCGCCCATGAACGTCTTCTCATTGCTAAGGAACCGTC
CAATACCTTGTGGTACGAAGCTCGTCGCGGCTTCGTGTCCACGATTCGTCACTCGACGCTGTTCAACTTCAAGCCCAAGGGCGAGTACTTGAGAGCGCGC
GCTCATGTCGAGTGGGGACTAGCGCAGAACTTCTTCGACAAGAACAAGCAGGGCAAGCGTAGCTTCGAGATGGCGCATGAGATCAGTGGTCTCACTGTGC
AGCTCAGTGGTTCGTTGGGTAAGCGTACCAAGTTCCAGCAGAAGAGTGTCGCGCAGATGGTGCTTCTCGCGGCGTCCAAGTACGCGCTAGATGAGGAGCA
GTCGCAGTCCGAATCCGCTACAGCACTAGCCAACACGACGCACGCTGATTTCGGTGGCcgCAAGGTCGaGgAAGAGAAGCCAAAaTGTACCAGATGGagA
ACTGACGGAGGAAGAACTGGCCATTCAGAAGCTCGTGCAAGaTGGAGAGGCTGCGTACCGTGACATTGCACTCGACCAGGTTGACCCAGACAATATCTtG
TtGGAGCAGATTGCATtCGAAGACAAGGCGCTGACGGAGCAGGgCAACTTGCAGACGATCGACCAAGTCATCCTTCTGTCGCTGTGTCTCGATGTCAAGA
ACAGCAATGCCAACGATGGTCTTACCCGCGAAGAGATGTTCCCGTACATCACCCGTGTGCTCGAGAACCCGAAcAACTGGATGGTGTACTCGACCGGTCT
GCTCGAACGCGCGTGGCTCGAGTGCGAGACATCCAAACGTCGCGAGCGAGCTGTTCTCCAGATGCAAGCGCTCGTGGACCAGCACACATCCCGCTTAACG
GTCCTGCAAAACTCGCTCAAGGCGATCGAGGATGCTGCACCAGCGCATGAGCGTATGCAGTTCGTCCATGCATTGGCGTTCCCTCCTCGCTATGCGTTGA
AGCGTGACCTTGGCGAGCGCTACTTTGCCCTGGGCGTGGTGCGTAGTGCTGTCGAGATCTTTGAAGAGCTCGAAATGTGGGACGACGTCGTCAAGTGCTA
CCAGGTTCTTGATCAGCCGACGAAGGCGGAGAACCTTGTTCGTGATCGTCTCGCTGTCGCACCGTCGCCATACATGTGGACGGCCCTGGGTGACATCACC
GGTGACATTTCCCACTACGAGACTGCCTGGGAAGTTTCAAAGCACCGCTACGCGCGTGCCAAGCGTTCTCTCGGTCGCCACTTCTTCGAGAAGGGTGACT
ATGACACGGCCATCAAGCACTACCTGGACAGTACCGAAGTCAACCCGATGAACAGCAGCGCGTGGTTCATTCTCGGCACTATGTCGaTGCGCACGCAGAA
CTGGACCCTTGGTCTGCGCTCGCTGACTCGTGTCGTGCAGCTTGAGCCTGACAACGGCGAAGCgTGGGgCAACATtGGTTCGATTCACCTTaCGAACGGT
CGCTATGCTGAGGCATACAGCGTGCTCCACGAAGCGCTCAAGCAGAAGCGTGAGATGTGGCAGATGTGGGAGAACTACGCCTTCTGTGCGATCCAAGTCG
ATCGCTACGGTGAGGCATTGTATGCTCTGCATCAGTGGCTTGATTTGCGCAACAAGCACAAGCGAACTATCGACCACGAGCTCTTGGCATGGCTGGTTGA
GGCCATTGTGTTCCCcGAGGAGCTTGAAAAAGTCGACGCTGCGAACGGTGAGAACGACGAGCATGTCAGTGCTGCGCTGCAAAGCCTTGACATCGATGAC
GAAGACGATGATGAaGACCTGTCGACGCTTGACGAAGCCGCcGAGGCCACAGACAAGACGCCACcGcGCTCCAACGCCAACTACAAGAAGCAGCTCGCTC
TCCTGTTTGGCCGTAT