Description :
From Genome Similarity Track
Location :
contig_75:46167- 47574
Transcript NameFunction/comments
g9996.t1hypothetical protein

Sequence
1407 bases(100 bases per row)
CTGCATGGTCCTGAAGCGAGCTCTCGCTCTAGCTCCTTGATTGAATTCATACAGGAGAGCACCACAACTCAGTTGCGAAACTGGTAACCATTCTGGTTCT
TCATAGCCCTTCCATTTCACGAGATACTCTCGTGTGCGTCGTGCAGTTCGAGTGCGTTTATTCCAACGCAGATCCAGAATTTTCTCAACTTCAAACTCGT
CGTTCAGATTGTCTGCCTCCCAGCTGTCCTCGGGTAACAAAGCGGTGTCAAAATCATCATCCTCGTCCAACTCGATTGCTTCAACTGGACGTTTCGGGAA
CAAAGCTCTCGGTTTCAGGCGACTCACATGCACCCAAGGGTTGACCCGATATCCAGTGTTGGTGACTCTCAGCTTGACTCTGAAATCATCATGCATCTCA
TCTATCCTGAACGGACCATGCCACATATGAGCCAACTTCCTGCTCAAACCAGTCTGCACCTTGGGGATGTATAGCCATACAGCATCGCCAACCTTGAAAC
CGGCTTTGAGACGCTCTGACAACTCCTTCCATTTCTCCGTCTGAGCTTCTGAGCGCTGTCGTTTCGCCTTTATCTGAAGGTCTTTGGCACAGGCCTGGGC
GTAGCTATAGTCACGTTGTAACTTCCGACGCCATTCGTAAGCGGTACGTTCAACAACGCCTGAAGGTTTGGGTCCAAGCATTGCTGACACCGTCCCTTGA
GCATCCCAACCATGCACCAAGTAAAATGGTGTATCTAACCGGGTGGCGTCAAAAGACGTGTTCAGGGCAAACATCAAACGTTCAGCGTGATCGTCCCAGT
CGCTTTGATCTGATTCAGCCACGTAAGCACGGACACTTCGCATTACCGTTTGGACCGACCGCTCTTGCTGGCCGTTAGCTTGAGGTCGATATGCTAGGGT
TGCTCGTTGCCTGCTACCCAGCATTTCCCGGAATCGGGTAAAAACTTCACTCATGAACCTTGGATCCTGGTCATGCCTCAGCATTGAACTTGCTCCGAAA
CGCCTGAACACACATTCCTCGTAAGCCTCAGCAACTTCTTGGGCAGTGGTCGAACTCATGGGCTTGCACATCACGTAGCCTGAAAATGAATCCTGAAACA
GGAGCAGAAAAGTATTCCCGCGTTCAGATTTGGGCATATGGGTGACAAAGTCCATTGACACTAGCTCAAACGGGCGCTGAGGTTCGATATTTCCAGGTGA
AGGTCCAGAATTAGGAGGTCGTCCCTTGGCCGACGCACAATCAGTGCACTCTTTGACAAAATCTCCACATCAGCGAACATACCTGGCCAATAAAACTCTG
CACACAATCGTTGATACGTGCGAGTTATGCCTTGATGCCCACCTTGAAAATCCTCGTGCACATAGTGCAACATGTCTGGACGCAAGCTTTCAGGAACAAC
TAATCTC