Description :
From Genome Similarity Track
Location :
Scaffold_941:4615- 6429
Transcript NameFunction/comments
Phyag_g8801Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1814 bases(100 bases per row)
TAGGAAAGTAGCAAAATGCGAGTGTACCTCGTAGTCGCCTGGTGACGGGCCTGTCGCCTTTTGACTTTGGTGGGGTCGACTGGTTGACGATGCAAACATG
GACGAAGCCTTGGGCTGTTGTCGCTTTTTGCTGGATTGACTTTGATTTTGACGCTCAGCTTCTTGCTCCTTCATATCCCGCTCAAGTTGGGATTCAATCG
TCCCGCGTGGCGCACCAGATGAAATGGTATCGAAGCGCTTGGTAGTACTGCCAAAGTTCGTGACTCGACTTGTCTGGAAATTGGAAGCATCCCAATTAAC
TCAGCTTTCTAACAAATACAACCCCGAACACCACAGCAATTCTTACCACTTTGTTTAGTACATCTGCCACTGCTGATGGGACTTCGTACGATCCCGGCGC
AGCCAAACTCTGATCTTTTTCTTTTGGAGCTTCGAACCGCTCCTTCTTCGAGCTGAATGGCGCCTTTTTCCTGCAAGACACAGATCGGGGCTGCTGGGTG
TTGCCTGAGGGCGGGTAATAATACGCACCGGGCCCTGGAACGAGCGCTTCACTACTCACAAGCACCCCACAACacgtcaacaacaaccacgacAAGGTAT
CAACAGCATTTACTTACCGCTGCGAAGTTTCAAACCGATTCGACGTACTTCCGAAGAACTGCAGATGTTCGGGCTTGCTCTCGGTGGCAAATCCGTGTGT
TTGGTTCGGATGGTAGGCTCCAGGTCCAGGTACGTTTTTCGTTATCGTGGTCGGTGCTGCTTGTTCTCTAGTGAGAGCCGATTTGAACACTGCATTAGTC
CTCGCGGGATCCTTGGCCACAGTTGCGTCTCCGGTACTCTTGTACTCCCCAGGGCCAGGAACTTCTGCTTTTGATCGGACTTCGTGTTCTATGAATCGAG
TCACTTTTCCCTTAGAGAAGTCGGTTGTGCGAGTCTTGTTGATACTTTTGAGGCCTCGCATCGGCTCGTACTCTCCTGGTCCGAGGGTGTCGCTACCACA
GCCAGTATGTCCAACTTTCGCGGGTTCGTGACGAACGAGCTTTCCATAGGCTCCTTGTTCGTAGCCAAAACTTTGAGAGACAGTCGGAATCGATGGAGCA
GTTGGAAGTCGCGTCCACCGGATCTTGTTGCTTGGTGGGGGCGTTCTCACTAGCGGGTTTCCGAGACTTGTGTGCCTATCCGAGCAAATTCACCGTCAGT
GGTCAGTGCCACACCTGAAGATCATTTTCAGAGCTTACGTTTTCGATTTCTGAGTGAATGGGTCTTGCTTCGCGTATGCTCCTGGTCCTGGTGTGCTATT
TCCCCGACGGAGCTTCACTTCCCCAAGCCGTTGAGATTTCGACTGGAAGATCGATGTAGCCGTGGCCGTACTCTTGGTCGGCGAATCCCAACTTGTCTGG
TTACTCGCAACGTACGATCCAGGTCCCGGAGTGATCATGGTCAAGCCTTTGGTCGAGCCAGCATTGGCACCGCGTACGAGCTTCTCACCAGATCCAAACC
CCGCAGCATTCGGACGCAcacgacgagatggcgaGGTTTCGTAGTATCCAGGCCCAATGGATGTGGATGTGCCAGCTTTCGCTTGTAGACCACCAGGACA
ATTATCGCGAGTTGTGCGATTCACCCACGCCATCAGGTATCAACGTGTTAGCTTCTGACATGAGTCCAGGCCGATGCCGTGCTGCGTATAAATAGTAAGG
CAAGCTGCGGTGGTTGGAATTAGACTTCGTCATGATGCTTCGTCCAAGCATTTAGCTCGATCGATGGGGCTGCATTGTCGGGGGCTCATCTGGAGCACCA
CCATACGTCGGGGG