Description :
From Genome Similarity Track
Location :
Scaffold_1013:4614- 7337
Transcript NameFunction/comments
Phymu_g12565hypothetical protein

Sequence
2723 bases(100 bases per row)
CCATATTGAAGCGTCACCATCTGCAAAGTCAGCGATGACATCGTTCCCAGCTTTGACTCGCGCTAAGAAGCTGTTTCTACTTCGGAAAGATGCTGCAAAA
CGGCGTGAAGAGGACGCACGCAGAAAACTTGACTATTCCACTCAAGTTCGTCAACTTTCGCCTTCAAAGAGATCAgtggaagctcaagatggacgaAAAA
CAACTCCAAAAGGAGCAGAGACTGCATCAAGTACACGCCAATGCACTGCGTCGTTGATTGCCTTCTGCTCAGACTTTGACGACCAATTGCAACTCATCAA
CAGCGACTTGGTACAATTCAACACGTCTGCGAGACGCGAGTACCAGCGCGAGTCGTTTGCTCTCGAGAAACTGACAACCAAACTGCAGGATCGAGACCCG
AAATGGcttgaagctcctccagtcAAGAATCGATACGCCCAACGCTGCCACGTTCGACTGGAGAGTCGGAAACCGCGTATCAAGCTTCAAGTGGTTCTCC
AtcaacaagcgccagctGTAAAGCCACAAACGAATCCGAAAGATCTCAGTCCAACCGCTTTGCTAGCACTGCAGACAGTGAAGGCGTGTGTGATCCAGTC
CAGCACTCGACGTCACCTCTATCGCTGTCTGTACCGTGGAGGTCGACGTCACCTCGTCGCAGCCTCTCAACTCGCCACTCGTTGTCGTTTCTCCCGAGCT
TTTCGTCACTGGCGACGAATTACCACTCAACGCCTGAAGTTTCGACTGCGTTGTCAtcgagcccagcagcgcatcGAGAGCTGCCGGTCTTCATTCGCtc
gttccagagctttccaagtggttgaagctgaagggAAATACGCTATGGCCAAGGAATTTCAGCACTCCAAACTGTTGTCAAACAGCTTCCACGCGTGGTT
GGGATGTTACCAAAACGCAATTTCTTGTCCTACGTAAAGAGTTGTTTTTAGTCTAACCACTTTGCAGCATACAAAAAGCAAGACAACCAAATCCTACTCA
AGAATTAGCTTGTCAAAATTCGATAACGGACGACGTTGACAATCATGACGCCTTCCCCTGTTGGCTCCTCTGTGCAGACAATGCGTGCTCACTCCATCGT
GACGCTCGATGGATACGTGAGTCATGGCAGGTCTCCACCGATTTCGGTGCCTCGCGATCACGCCATGTTGCAGGAGTTCGCGCTCTATTTGGAGCTGCGA
CTCAAATGCTTCAACATGTCGATGCTGCGTCGCATCTTCGCAGATTTCCTcaacgagcaggagaacacGCTCGTCCCCATGATGAAGATGGGATTCACCA
TTGTCACCATCTACCCGGTGCTGCGAACGATCCCCAAGAGGCTCGAAAAGGCGAAGATCCTGCTGCACAATCCGAAATCCCATCTGGATGCGAACGGATG
CGTCTTCCTGTACTTGCAGTACTGCACCGCGACACGGAAcatggcgctgctcaagcgaTTGTTCTTGGAGTTCGCGGAGCATCGCGAGACTTCGCTGCTG
ACCTTCGTGAAGAGGAACTTTGAAGTGATCAGTGTGATTCCGTTCGAACTGTCGCAGCTACCGATGCCCGTGCGTTTCTAGCCGCCacaagtgcagcagg
agccaccaagagcagtggaagctgtaCAAGAGCAACCTCAGCGGTGGAGGAGCCTGTGGCGAAAACCACCAAGAAAAACTCAACCAAGACGGCTCTGGAG
AAGACAGTGACATCGATCCAGTCgcccacagcttcgacttcggCTCCAGTTGCTTCACCTGATGGAAACCAGCAACCAGTGGGGAAgaggctgagaagaa
gatctAAACGTGCTTCTACGACTGGAGATAGCGCTAAttcgaggacgacgccagctccagaagctACAAACGATCCTCCAGTTGTATCTACACGACGAAA
GAGTGCACGTAAAGCTGCCACCACTGATGCGGCTGGGGCCAATGAGGCCAACCAGACGAGTGATCTTCCTGCTTCGGGTTCTGCTGTggtggcagctcca
cgacgaGGCAGAAAGCCAAAGATTTCCACTCTTCCAACGCAggaaacagcttcaacctTGGAACCAGTTGAATTTGGATCGCCTGAAGCCTCAACTAGAA
GTGCTCAACCTCCGGCGCGGAAAAGAGGCCGAAAGCCTCGCAAACCGGAGAGTGACGAGGTGACGCAAGCCAAACCGAAGCGAGGCAAGCCCGCCATGAG
CGAGGAGACTTTGCACAGCCAACTCGAGTTAACGCGCAGGGTGAAGGTGTTCGAGGAGCAGATCCCGTGGGAGGCAGTGTACGGGAATCTGCCTACCCCT
TTCGACGAGTCGAAATACGCTGCGTTTTCCGTCAAGTTCCGCGCGTTCTGGCGCAAACACGCGCGTGCCGTGTGGGAGCGCAACTTCTGGGCCGCCATGT
CGCACAAGCTCAACCCGAAGGACTTCAATGAGCGCAACAGCCGCCAACACGCGGCCAAGACCGCGTTCGAGTCGCTCATTGTCGCTGTGTACGGTGAGTT
CGGAGCGCAATTCTTCGTCAAGTTGGACGCAGAGCGACACTGTGGCTGGTGGTACCGAGGGCCCGTTGTGTCCCTGTTCGcactgcaggagctcaagggG
GAGCGGGTGATGTGGAAGTACGTCAAGGAGGACGCGCTCAAGCGCTTCCCGGACTGTCATCTGCCGCTTCCTTTGGCTGCGCCCAACTCTGGGGCCATGC
GAGCCCGACACGAACGAGAGAGC