Description :
From Genome Similarity Track
Location :
Scaffold_1156:4614- 6147
Transcript NameFunction/comments
Phyin_T30-4PITG_22013RXLR effector family protein%2C putative

Sequence
1533 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNACAGCCTTACTACCAGAGAGTCGACTCTTGCCACGATCCGATATTCAAGACGTGGGTCTCGTACATGAATGCGTTTGTCTCTAAAAATTCT
GGCAAATCGGACGAGCTGTTTTCGGAATTAAGTAGCGTCTTCGAGGGCGTGGCTTTTTCTCGGATTCTTACAGTAGCCACTAAGTTCCCTAATCTGGAGA
GTACTGCAACCAAGCTGCGGTATGAGAAGGCTTCGACAATTTTTGCTAGCAAAGAATCGCCGGAGAAGATATTCCAGCTACTAGCACTTGACGATGTCGG
GAAGAAATTACTCAGCGACACTGTTCCACAAGTGGATGCGTTACCAGGCCAGTTTTAACAAGGCCAATCCGAGGCATCAAGAGTCGTGATTTAGTACGCT
CCGTGTTAATTACAACTGGGGTGGAATAGAGAGAATTATCGAGACAGGAAGACAGAATCCAAGTACAAGAGAGATGGCTGAAAAAGTGGAGGATGCGTTT
CACAACTACTGGCTGACTACTAAGACGACGCCTAAGGTAGCCTTACGCTTCCTGTATCTCCACGAGATTGGTGAAAAAACTCTCGTTAACCCAAAATTCA
GCACGTGGGTAAAGTACCTGGATAACTTCAACGATCGATACCCTGGATAGAAGACAGCAGTGATCGACGGTCTCCAGGCTCACGACGGGAACAGAGCTCT
ACTCCAGATGTTTAACGCTGCGAAGGAAGATCCCAGCACGAAGAAACTCGTCACTGATCTACAGAGTGCTCTAATCCTCAAGTGGCGAGATGCGAAGCAG
ACACCAGTATGCTCGATGGCGTGCCAAACTCCCGTGAAATGATTGATCGATACACCACGCTAATATCGGGGACGAGAACAACCACTTAATCAATTCCACT
GAAGCGGCTAACAAATGTGATTATTGTTGATCATAATTGCGTAATGTGCGTCCTTGGAATGGAGCCACAAATGTGCCCACCGCTTTAACAGGTATCGTTT
TTTTAGCGGTGCACTTCTTTTTCTTTTACAATA