Description :
From Genome Similarity Track
Location :
scaffold_63:46121- 47358
Transcript NameFunction/comments
g2507.t1 hypothetical protein PHYSODRAFT_353702

Sequence
1237 bases(100 bases per row)
CTCTGTGCAAGCCCTCAACTCAATCCGATCGGATCAAGTTAAGGACTTGCACAGAAACCCTCGATATCAAAGAGGAAAGGAGCCGCGCCGGCGTTGATCA
CGGCTTCGTCGCCAAAGGCGTGGAGCGACACAGCAGCAGCGTAATCTCCTGGCAGCACCTCGGTGGGTGCTGCTCCGACCATCTCACCATTCAGGGTGAA
GAAGAGCTGGTGCTTGTCAGCGTCCAGACCACAGCCAACCGTGAACATCGGAGCGACCTCCTCCTGGTTTTCGGACTGAGCCACAGCTCGGCCCCACGAC
GGACCGAAAGCGCCCCACTCGCCACCGTACGGCTTGGCGCCATCGTTGAAGACGAAGTCGCCGTCGTTGCCGTGGTAGGCGTAGGACACGCCCTTCCAGC
CCACGTGCTCTCCAGAGCCGAAGCCGTAAGCGTTCCGGGTCGCCGCGTCGGAGACGGACGCGAGACCCACGCTTCCGCAGCCTTTAAGGCCCACCTCGTA
GTATGATATGTTCTTATGCAGAGCACGTGCACAGGAGAGCACAGGAAGTTTCTTGGTGCCACGGAGTGAGTCCACCGCGCCCTTCTCGAAGTTGCGAAGC
ATAGAATTGTTTACGACATGGTAATTGCCGTTGGGCAGGCGGTTCACGTTGCTGCGCGTCGACAGCTCATAATCCGTGTCTGGTAGACGCGCAGCGCACA
GCGCCAGCTGGTCGGTGTACGGCAACGTCACGTACGCCTCCGGCAGCATTTTAGCGCGCCATTGGCGACTGTACAGGCCTGTAAACAGCATCTCCGAGGA
CGCGACGACGTCGTGGAAGGCCGTGCAGATCTGGGCGGCGCATTGTAGCTCTTCCATCGTTAGAAACTCGAAGCAGAGCTCGAGGGCCGCAAGCTCCAGG
GCCTCACCGTCGCGTGTGTGGCGACGCTTCAGGCGTAGCGCGGCCAGCAGATCCTCGATCTCAGCCGTGTTCTGCGCGCGCTGTAGGTCGCTCCAGCGGA
TGTTGGCTGGCTGGTTGTTGCGCTTGGCCACGGCGGCGTACGATTCGTACACGACGCAGCAGTCCTCTGGCTCGAGATCTGAGGCTTCCGACTCGTCGTC
GCTGGTGTTGCTGGCTGTGGAGCAGGAGCTGGTGATGCTGCCGCGGCGACGCGACAGACGGCGGACGGACGGCTTCTTGGTCAGCACCACGAACGAGTTG
AGGTGCGGCAGGCGCGACGACATGGTCGGCACGGTCG