Description :
From Genome Similarity Track
Location :
Scaffold_18:461202- 462921
Transcript NameFunction/comments
Phyca_LT1534110373predicted protein

Sequence
1719 bases(100 bases per row)
agtccagaacgccgcgagcatgaatcttgccctgatcgtaataccaaccaaagccaggaaattcgaccgacctcgctgccagcaccgctttctggcgccg
aggtgtgtggaaaactaatgtagaagtaaacttcgtgtttgtgtctcactaatacatttttcagtccactcaagcgttgctgaaagctaaaatccgcgaa
attcagtcgagtccagtgctgacaccgaaacaaaaagccgagtcagtgcagaatctcatgatgaaagactggaacgatgccaagtcaaaagcaggtgctg
ccaaaatcgaatgcgataaagaagccgaacggaaacaaaagtcatatcacgtacgtcaagaataatgttgcgcggactacatgtagctgacctagatttc
gtgcattcttcaggatgaagctaagacagttttgggatgtagccactaccagtacgtggttttcattgatttacgagatacgaaacccccaggctaatct
gttgtggctattcaggcgtaagtgcaagctgctgggcaaatgctgtgggaaatggtatccctgtcgcttttgtcacggtaagtcgtgctattatcaacgc
cttctagccaatgtctagctgacgttcttacagatgacaacgaggaccacgcttttgatcgttacgcggtagatacagtatcgtgcatgaagtgcgatac
agtccaaccaatcgggcaaatatgcatgaatgaagactgcaaatgcgaattcggccgctactattgtgaggtgtgtcggttcctcgatgacgatcataac
aaagacatttaccattgcgacaaatgcaagatctgccgtatcggcaaagggctggacatcgactacttccactgcgatcgatgcaatgcctgcatgagca
tcaccttgaagaaacacaagtgcgtagagcgatcgctcgagtctgactgcccgatctgccacgcgtacatgttcacgtcgacgacaccagtcatgtttct
cccttgtggacactgtatgcacgtgtcttgctacgaggagtacaccctcgtacgtacaaaagtttcgatgtgttgactaccattttggtatttgctgaaa
caattcttgtcgtgcattttggcagacaaactacatctgtccactgtgctcaaagtctctaggggacatggagctgtactttgccagtatcgacgaactc
ctagagcgtgagcggatgccagtcgagtacgacgactacaagtcattgatctactgtagcgattgcgaacgcaagtcaacaaccaagttccacttcgtgt
atcacaaggtgcaaacaatttgccaatgacaatattcaagaacttacgtgtcttgttttgtagtgccaattcgaagactgcatgtcatacaacaccaagt
tattaagacagtttaaagactccgacggacaggtagcgtgcggccccataagtcagacctagagtctttagcaagaaagtcgcataacagcaaggaattt
caccaaaatctaccatttttttgttgatatgtatgacccagttcttgaggagtttgacgaatggacaagtcgtcgtcctctacacacatagaatcattga
aattcactctagcgcccgtgggggtgacacgacatgcctcggtcctccaatgcagcgaaacacttttcagcgccccaagcacagaagaaccttgcatgcg
tgtgcctacagcgcaacat