Description :
From Genome Similarity Track
Location :
Scaffold_395:4611- 5636
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20261hypothetical protein

Sequence
1025 bases(100 bases per row)
ATAATGTACTCGGTCAGCGCATCGACTCGTCTTTCCCACTGTCCTAACACAGGTAAACGGATTTGTGTACTTGCAATCAAACCTTCGGGATCTTGAAGCT
GCTCTTCGAGCCATTCCTTCCGCTTGCGAGAGGTCTGACTGTCGGTAAAGTACGCGTTATCGATAGCATCGGGTTTATCCCATTGGTATTCCTCGGTTTG
GCTGTTGAAGTAGTACGGAGCTTGAATCATGTCATCAAAAGCTTCGTACCAATTACATGACGAGGAGTGCTGTCTGTCCCCACTGGTACTTTGTCGATCT
GAAAAACTGCGGTGACTATGTGGAGGTTGATCAACATTATTGGTTGCAGGTGCAGGTACTTCAATAGATTCCGTCAAGGGCACTGCAAATTGATCTCCGA
AAATGTCCATTGCTAGTGGTCGATGCCATCGTGTAGCACCTGTCAGCGCGTTGTAGTAATAGGGTCGACCATTATCGGGCGACACCATTGGAATCCAGCA
ATTTCCTCCCTCTCGAACTGCTGCTCTTACGCGAAAACCGCGGAATATCTTCTGAATAGTAATTGCCGCACGGCGTTCGTGTCGAACTTTATCTTGCAGT
CTCTTCACTCGATTTTCGCGAGTTTTCTTGATGACTCCCTCGGTTAAAGGTTCAAGCTCTCGCCTAACAGCCCGTAACTGTTTCTGAGCGTCGTTCAGAC
TTGTCGTCAGTGTCTCGTACGCCCGATCATCAAGTGCGATCTCGGTTCGCTTTGCTCGAAGCTGATCCGCAAGCTGAACTTGAAGGTATTGCGTTAGATA
ACGTTGTGGTGTTCCGGTGATACGGCTCGAATCGTGATATTTTGTCTTGATCTGAAGCGTTTTCTCGAGTTCTAGTGTCAACGAGCGCTCTTCAGCTCCA
TCGACAGTGATTTTGCGTTGAAGCTGCTCAACTTTATCATTCAAATCAGACACCAGCGACTGGAAACGTGTTTCTTTCGCGAATAATGGTTTTGCTTGAT
GACGGAAACGTTGTAGCTCTCTCCG