Description :
From Genome Similarity Track
Location :
scaffold_3:46102- 48696
Sequence
2594 bases(100 bases per row)
TTCTGGCTTCCCTCAGAACGAAAACATCGACACGAAATTGATCGTGAACCTGGCTCAAAGCATGCAGTGCCTTGACGGTGGCCGCTTTCTCGTGATCCAC
GTAAGAATGTGGattagctctttgctcaaaggTAAGCTGCTAGTCTGGTTGAGGGAGAGCAAGTCCCTCACAGCGCCGACGTTTTGTTTGCACAAATAAA
ATAGTAAATGGCAAATTGTTCACGCCTCTAACAAGTTGAATGAGCAAACGGTTTCCGCTCAAACGCCAATCTGCGAAAAGTGTCATCATTCACTGCATGC
CcggatgtacaaagtttaATGTGCTTAATTTAGTTGATGAATACTACCAAATCTTGATGATTGAAAAGGACGTCCCTCTAACTACTGTTTGCGCACCGTC
CGGGTCGTTATGGGGGCGCCTTCTGATACCACAAGATCTAACCAATACCCCAGCACCTTTCAATGGATTGACCTCCAATCTGTTTCAACCACTGCGACGC
TTAGCACAAACCTATTATAACGATATTTTTGTTCATTCAAGCGACGAAGATGGCAAATCTGCCGAGAAAGTGCGCTTGGAGAGCCTCTGTGCGGTGCTGG
AATGTATGCGTGAAGTTTTATTGCAAGCGAATGTTGCGAAGCAATTTTCGGTGCTAACAAAGTACCGGCCCTCGGTTGTTATGTTGGCGAACACGGTGTT
CGTGCAGATCCCAAGAAGCTCAAATCAATCATGAAGTGGCCAGTAACATGAAATTAAAGGATTTGAGGAAACAGACTGGGTTTTCTGACTACCTGCGTTG
TCACTCGCGCAACTACACGGACATGTAACGCCCAATATTAAACTTGCTCAAGAAGGACGTACCATGAGAGTGGTCGTCTACTTGTGTAAAAGCGTTCGCT
CAAATCAAGAACATTTTGATGGAAGCACCATTTCTTGGTTTACTAGATGTTAAGAAGTCGTTTAGCGCGATGTGTGACGATTCTGGGTTTGCAATCGATT
GTGCACTATTGAAAAAGGAACCAAAAGGATACGATCGCGTCGTGTCGTTTAAATCGCGACAGCGGAAGCCAGCAGAAAAAAAACTATTttgttcacgaca
aggagcttTTAGCAATAACATATGAAGTTATGTGATCACTCTTGAGTTCTACTCCGTTGTAGTCTACAAGGATCTTACAGCCTTACAATATGCAGTTTCG
CCATGTCACTTATCACAGCGTATGGCTCCTGGTTTACATTTTTCGCAGAATACAATTTCACGGTCGTGAAGAAGCCAGGGAAGCTGAATGTGCTAACAAG
CGCATTTTCGCATCGTCCtgatatgagctagctcatatcTGTTATATCGAAAGCAATGTATTCGATATGATACGCTAAGCGTATGTTGGGGACGATCAGT
GTGATCTGATTGTCAGAGCTCTGTCGTTGAGTGATATAGAGCTCCATGACAAGCTTTCAGCCGCTTGAAATCAAGGTTGCATGGAAGGATGGTCTCCTTC
ATTATGGAGTTGCACGTGATGATGAGCCACAGGGTGTGGTTCCCCACAGcaatgatttgaagcacaagaTAGTGTACAAGGCGCATGATATTTGATGGTC
GGTCGCTTTAatcgtgaaaagacctacCGGTCTCTCAGTGCCAATTTTATGTCTCCCCGCATGTACAAGCGGGTTGCACGGTACGTAAAGACATTTGATG
TATGTCAGCGCGTGAAGTGCGCACGTCATACTCAAATGCCTCTCATATATTAATCTTGTAAGTCCTGTAGAAATATTAAGTAAAAGCTATACAAATTTTA
ATAATCACATATAAATataaaatcaaaataattTAACGAACAGTTTCACTAATACATCATCTACTGTTCCTATAGACTTTTGGAAGTCAGTCTAGGGTTA
GGAACACAAAAATGTACTCATGGAAAGTCGGTGACTTCATCATCGGGTTTTCGAGAATGCTGGTGGTCACAATGGAGCGCTCTTTTTCGTCGACaaactc
agcaagatggtttgaaTCGCGACATATAGCGATTCCATCGATGCCGAAGGTTCGGCTAGATTATTTATTGATCACGTTTTCGGCAATCACAGGTTGCCAG
ACGCCATCACCTCTTATTAAAATATACGTTTACAAGTGAGTTTTGCAAAGGATTGTTTCGAATCTTGTCACTCGATTGGATGTATCCACAGCGGTACACG
CGTAGACCGATAGGCAAACAGAATAAGCCAACCGAGCTGTCGGTGACGTGCTGAGAAGCTTCTGTGTGAAAATGGGGGTTTGTTGATACCACCTCTTATA
GTTTGCTATGAACAATTCAGCTCATTTACTCAAATTATGCCGTTTTTTTCATAAATGGCCTGCAACACCAGCAAGTGccgctttgtgcgatgaTTGATGT
CTCTGATGTAAGTTGAGGAGGAGCTCGGTATATCGTTGCCTCTCAAATTGATATAATCAATGGTGCAAATGTAAAGCGCAAGTACAAGAACGACCTGGAC
AAATTCATTAAAGTCGGGCGAATTTGATCTCACATGTGCGAGTTACAATGGCCAATGCACAAGATTGACAGCAGAAATACGCAGACAGACGAGG