Description :
From Genome Similarity Track
Location :
Scaffold_1164:461- 4159
Sequence
3698 bases(100 bases per row)
GGTCTGCACTGATCACCGTAGCTAGTTGCACACTCGGTGTAGCCACAAGCTAATCTCCACAATTTCATGTCATTCACGTTCATCACCTCACTCCTTCGTC
TTAGTCTTATGTCATGCAGTCCGTCTGCTCGTCATTCTGTCGCTCACTCCATTCAGGGGCGCAGTCACTGGTCGATTCAGTCGGTATCTTCATTTTTCCA
CTACTCCACTCGAATTCTCTACAAATTCAGCGTCGACAGTTCACAATCAAAATCACATTCAGTTTCAGTCAGGTCACACGTCGGCGGTCAGGATCAAGTG
TTCAATCCGGTACTAGACACTGGGGCGGTCATCACCAGCCTGCATAGACTGGAACCTGGCCTTAGCACGGGCACTCTGATTGAATTCATACAGAAGCGCA
TCACAATTGAGCCTAACCACTCAGGATCGTCGTATCCTTTCCACTTGATCAGGTACTAGCGGAATCTCTTGGAAGTACGAGTGCGCTTGGCCCACCGGAG
GTCCAGAATCTTTTCCACTTCGTACTCATCATTCTGTTCGTCCGGCTCCCAGCTGTCCTCGGGCAGCAGGGCTGCATCGAAATCGTCGTCATCATCCCGA
TCGAGTTCCGCGGTAGGTAGCTTCGTAAACAGAGCGCGAGGCTTGAGGCGGCTGATGTGTACCCAGGGGTTAACACGATATCCTGTGTCCTCCACCTTGA
GTTTCACTCTGAAGTCATCGTGTACCTCTTCGATCCTGAACGGCCCATGCCACATGTGAGCCAGCTTGCTGCTCAATCCGGTCTGGACTTTCGGGATGTA
GAGCCATACCGAATCACCTTTCTCAAATCCTGTCTTCAGCCTCACGCACAATTCTCTCCACTTGCGTGTCTGTTCTTCCGATCGTGTTCGCTTCGCTTGT
CTCTGGAGGTCCTCGGCACAGGCTATTGCGTAGCTGTAGTCGCGCTGAAATTTCCGACGCCACTCGTACGCAGTGCGTTCAGGCACACTAGATGCTTTCG
GACCTAACATCGCCGTCACCGTGCCTTGCGCATCCCAACCGTGTACCAGATAGAATGGAATGTCCAATCGGGTCGCGTCGAACGAGGTGTTGAGGGCGAA
CATCAGTCGCTCAGCGTGATCATCCCAGTCAGACTGGTCAGACTCAGCGATGTAAGCGCGGACGCTTCGGATGACGGTCTGCACGAGTTCCTGTTGGCCG
TTCGCACGATATGCCAACGTGGCGCGCTGACGACTGCCGAGTAGCTCCCGAAACCGAGTGAAGACCTCACTCATGAAACGTGGGTCTTGATCGTGTCTGA
TCATCGACGACGCACCGAAATTCCGGAAGACTCGCTCTTCATAGGCCTCTGCTACATCCTGTGCCGTAGTAGACGACATGGGTTTACACATCACGTAATC
AGAGAATGAATCATGAAAAAGCAGTAGGAAGGTGTTCCCTCGTGCCGACTTGGGCATGTGCGTCACAAAATCCATCAACACAACTTCAAACGGGCGCCTG
GGCTCGATGTTACCAGGTGACGGTCCAGGGTTGGGAGGTCGCCCCTTTCCATTTGCACAGTCAACGCACTCCTTCACAAAACGTTCCACGTCGGCATACA
TGCCGGGCCAGTAGAACTCGGGCGTAACCGCTCGTGGGTGCGGGTAATTCCCTGGTGTCCACCTTGAAAGTCCTCGTGAGCGTAATGCAGCAAGTCAGCG
TGCAGTGTTTGTGGCACCACAAGACGTGGCTCATCCTGTACGTCCCGAGGTCGATCTCGAGTAGACCGCGCGAGTCGATACAGGATGTCTCTGGCATCCA
GTGCAAACAAGTCCGAGAGCTTCGCGATCTTGCGAAGCCGCCTCGAAGAGAATCGATCCAGGTCGCCACTCAGATACGCTTTGACTTCCGAAATGAACTC
ATCCTGATCTTGGTGTGCCTTAATCCTGCGCCACCTCTCGGCTTGGAACTCCAACGGACCCAATGGGCCACTCGACTCTGTCTGTTCCTGTGTTCTCGAT
CTGGTCAGGACCGCCATGACTCGAGCACAGTGAGGTAACGGAGCAGAACCGGGGTCCTGTTCGACATTGTCTGGTGACCCCACATCCGGTGTCACCACCT
TCTTAGCAGCCGATCCATCTGGTGCATCCTGAACTCCCTCACTCACATCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTCGCCTTCGACAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCGTACGGGACTGCAGCTACCACCGGGAAATCCT
CTATGAACTTGTGGTAGTAGTTCAGACTGCCGAGGAAGGACTGGATCCCCTTCAGAGTAGACGGGAATGGTAGATCCAGTACGCCCTTAGCGATCTTCGG
CGTCGCCCTGAGTCCTTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACTCTTCGGTAGACTGACAGAGATGTTCCAATAC
CGCAACCGAAACAGTAGCGCATCCAGATCGATGCAAAGTTGATTCCACGTAGGCGCCCCATGCGCGATGTCGTCAATGTACGAGCTCCGTCCTAGGACAG
GGCCCATCTGCATCGGTGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAGCGCGGGTAGACGTCGGCCAGACAGGATTTCGTCGTCCGATCC
GGTGTCGCTCCCTGCGACGTTGTCCTCTTGCGGCTTCAAACCCAAATAATCTAGTACGTCCTGATCCACCTGAGCTTCCTTACCAGGTGGTAGTCGAACA
AAGCCCCACAGACAGTTGTTGAGCATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATGCGTCGCCACTGGTAGTGACCGAACGGCGACA
CGAACGCCGAGATGAGCTTCGCTCCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGACTCATAAACCACATCGCGCTCTCGAACCCGATTAGC
AGGTCGTCAATGAGCGGGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACGATCCGGTAATCAATGCACATCCGGATGTTGACCCCGTTCTTCTT