Description :
From Genome Similarity Track
Location :
Scaffold_243:461- 2341
Transcript NameFunction/comments
Physo_144683reverse transcriptase

Sequence
1880 bases(100 bases per row)
GGCCGGATGACTTCTTCCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCCTCGGGACTGTGCGCGTTGCGACCTCCTTGACGCTGCAGAGCTTGTCCAA
CCAGCATGTCGGCACTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGGCGCGGCCATGCCTGGAGTGCGTTTCGCGTCTTTTGTCCCAGCAGCTT
CAACCCCGGGGACTTGCAGTCCATCTCGTCCCGCATCTGCCTGATGACAAGGTTGGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCAAGCTCCTCT
AGAAGAGAACATCCGAGCAGCAGCCCGCGGTATTCCGCCTCGTTGGCCGTGAGGTCCGTCGCATATCCCGACGTGGCGCGCACGATCTCCCANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTCGCGGCCAGCGCGCCGAGGAGTTCTTCTTCTCCCTTCATGGATCGGTAGATTTC
CAACTTCCACGGCGAGAGGATCGCGGCCCACTGTGACAGCCGCCCCTGTAGTCCTTTGGACCGGACCAACCAGGCGAGCGTCGTGTGATGTGTTAAGACG
CGGACCGGTCTCCCTGCAAGCATCGTGTAGCACTCGTTTAAGACGCGCAACAGGGCCAAGATCTCCTTTTCGACGATGTCGTAGTTCAGCTCGTTGGGCT
TCAGCGTACGGCTGGTGAACTTCACAGGCATGTACACATCGTCGTGGACTTGCGTGAGCACCCCTGAGATGGCCCAGTCGCTGGCGTACACGATCACGAC
GGATTCTCGGTTCGCGTCGAAGTGCTTCAACATTGGGGTCCCGGCGAGTTTTGCCTTGAGCGCATCGAAGGCGCGCGTCGCGTGCGTCCACTTCTCATGT
CCGCGGACTTCTGGACGCGTGACGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGCCTACACCGCAAAGTCTGCAATGAACCGGTGGT
AGTAATCGAGGCTACCCAAGAACGATTACAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCAGCGACTCCAGATTCTTCGGCCTCGCCTCGAGACC
GAGTCCTGAGACTCGGTGGCCCCGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGGACAAGTGCCACTGTTCGCAGACATCCAGC
AAGCGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTGCCCCCGATGAGGATGTCGTCGATGTACGACCTCCGTCCCAGAACGGAGTGAATACCTGGCT
TCACCGGTTTGCCGTCTTCAAAGACGTCCCGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGTAGAGCACGTTGTCGATCAAGCGTTGGTAAATCTG
CGGCGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGCTGAGATGAGGCGGGCCCGGTCTGTCATGGGGACG
ACCCAGAAGCCACTCACCATGTCGAGGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAAGTCGTTGACGAGCGGCATGGGGTAAATCATCAACT
GTGTCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATATCGACGGCGTTCTTCTTTATGATCACGACAATGGGCGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN