Description :
From Genome Similarity Track
Location :
scaffold_3:46099- 48524
Sequence
2425 bases(100 bases per row)
TCCTTCTGGCTTCCCTCAGAACGAAAACATCGACACGAAATTGATCGTGAACCTGGCTCAAAGCATGCAGTGCCTTGACGGTGGCCGCTTTCTCGTGATC
CACGTAAGAATGTGGattagctctttgctcaaaggTAAGCTGCTAGTCTGGTTGAGGGAGAGCAAGTCCCTCACAGCGCCGACGTTTTGTTTGCACAAAT
AAAATAGTAAATGGCAAATTGTTCACGCCTCTAACAAGTTGAATGAGCAAACGGTTTCCGCTCAAACGCCAATCTGCGAAAAGTGTCATCATTCACTGCA
TGCCcggatgtacaaagtttaATGTGCTTAATTTAGTTGATGAATACTACCAAATCTTGATGATTGAAAAGGACGTCCCTCTAACTACTGTTTGCGCACC
GTCCGGGTCGTTATGGGGGCGCCTTCTGATACCACAAGATCTAACCAATACCCCAGCACCTTTCAATGGATTGACCTCCAATCTGTTTCAACCACTGCGA
CGCTTAGCACAAACCTATTATAACGATATTTTTGTTCATTCAAGCGACGAAGATGGCAAATCTGCCGAGAAAGTGCGCTTGGAGAGCCTCTGTGCGGTGC
TGGAATGTATGCGTGAAGTTTTATTGCAAGCGAATGTTGCGAAGCAATTTTCGGTGCTAACAAAGTACCGGCCCTCGGTTGTTATGTTGGCGAACACGGT
GTTCGTGCAGATCCCAAGAAGCTCAAATCAATCATGAAGTGGCCAGTAACATGAAATTAAAGGATTTGAGGAAACAGACTGGGTTTTCTGACTACCTGCG
TTGTCACTCGCGCAACTACACGGACATGTAACGCCCAATATTAAACTTGCTCAAGAAGGACGTACCATGAGAGTGGTCGTCTACTTGTGTAAAAGCGTTC
GCTCAAATCAAGAACATTTTGATGGAAGCACCATTTCTTGGTTTACTAGATGTTAAGAAGTCGTTTAGCGCGATGTGTGACGATTCTGGGTTTGCAATCG
ATTGTGCACTATTGAAAAAGGAACCAAAAGGATACGATCGCGTCGTGTCGTTTAAATCGCGACAGCGGAAGCCAGCAGAAAAAAAACTATTttgttcacg
acaaggagcttTTAGCAATAACATATGAAGTTATGTGATCACTCTTGAGTTCTACTCCGTTGTAGTCTACAAGGATCTTACAGCCTTACAATATGCAGTT
TCGCCATGTCACTTATCACAGCGTATGGCTCCTGGTTTACATTTTTCGCAGAATACAATTTCACGGTCGTGAAGAAGCCAGGGAAGCTGAATGTGCTAAC
AAGCGCATTTTCGCATCGTCCtgatatgagctagctcatatcTGTTATATCGAAAGCAATGTATTCGATATGATACGCTAAGCGTATGTTGGGGACGATC
AGTGTGATCTGATTGTCAGAGCTCTGTCGTTGAGTGATATAGAGCTCCATGACAAGCTTTCAGCCGCTTGAAATCAAGGTTGCATGGAAGGATGGTCTCC
TTCATTATGGAGTTGCACGTGATGATGAGCCACAGGGTGTGGTTCCCCACAGcaatgatttgaagcacaagaTAGTGTACAAGGCGCATGATATTTGATG
GTCGGTCGCTTTAatcgtgaaaagacctacCGGTCTCTCAGTGCCAATTTTATGTCTCCCCGCATGTACAAGCGGGTTGCACGGTACGTAAAGACATTTG
ATGTATGTCAGCGCGTGAAGTGCGCACGTCATACTCAAATGCCTCTCATATATTAATCTTGTAAGTCCTGTAGAAATATTAAGTAAAAGCTATACAAATT
TTAATAATCACATATAAATataaaatcaaaataattTAACGAACAGTTTCACTAATACATCATCTACTGTTCCTATAGACTTTTGGAAGTCAGTCTAGGG
TTAGGAACACAAAAATGTACTCATGGAAAGTCGGTGACTTCATCATCGGGTTTTCGAGAATGCTGGTGGTCACAATGGAGCGCTCTTTTTCGTCGACaaa
ctcagcaagatggtttgaaTCGCGACATATAGCGATTCCATCGATGCCGAAGGTTCGGCTAGATTATTTATTGATCACGTTTTCGGCAATCACAGGTTGC
CAGACGCCATCACCTCTTATTAAAATATACGTTTACAAGTGAGTTTTGCAAAGGATTGTTTCGAATCTTGTCACTCGATTGGATGTATCCACAGCGGTAC
ACGCGTAGACCGATAGGCAAACAGAATAAGCCAACCGAGCTGTCGGTGACGTGCTGAGAAGCTTCTGTGTGAAAATGGGGGTTTGTTGATACCACCTCTT
ATAGTTTGCTATGAACAATTCAGCTCATTTACTCAAATTATGCCGTTTTTTTCATAAATGGCCTGCAACACCAGCAAGTGccgctttgtgcgatgaTTGA
TGTCTCTGATGTAAGTTGAGGAGGA