Description :
From Genome Similarity Track
Location :
Scaffold_23:460956- 463462
Sequence
2506 bases(100 bases per row)
ACGACGACGCCTCCGCCGAGAGTCGGATCTGAACCTGATTCAGATCGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGACACGGCCG
GTGGAAGTGTGTTATCACATCTTCGATGGCGGGACCGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGAACCGTTGCCAGAGGTTGCCGAGATACTGA
ACCTTAAGGAAATGATGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTGGAAAAGGTTGCCGAGATGGTGCTCATAAGACCTGAGACCACTCGGGAGGAGC
TGAACGCCTCCTCTGTTTTTAAACGAGGACGTCCTGGAGGACCTAAACAAGCAGCGTCAGACGCGCTTGGGTTCCGAGATCCTTAATAACCCCAAGGATC
CGGTGTATCCTTTGGTGACGGAGTATGCGGACGGAGTGAACAAACACCCACCGACCCAGATCCCACCAGATCGAGGCGTACGACATGAGATCGATCTCGT
GCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATG
GTGCGGGAGTCGAAGTCCCCGCCCTCGACACCAACTTTCTGCGTTCGGAAGTCGAACGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACG
CGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGCTGTTGAACAACATGGCCGGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATA
CTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGAGCTTGTCT
AACGCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTG
CCGAGGAAGGCAAGACGGCCATGGAGGTGCATCTGGGGTACCCCCGTCGAGTGCTGGACGTAATGCGAGCGAACAAGTTCTACGCCAACATCGACAAGTG
CGTCTTCGCGTCTCCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCA
ACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGTGCAGGGTACACGGGCTTCGCTGAGCCCTTGTCGG
GCCTCCTTAAGAAGGGCGTCGGCTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTGACAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCT
GCCAGACGATACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGGTTGTGCACTGCTGCAGGCCGACACGGCTGGACATGTACGAGTT
ATATCGTTCCAGTCCAGGCAGCTCAAATCCGCCGAACAGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTG
TTCACCTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGGGGACGTG
GCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGGGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTG
GCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGTACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTTCACGGCAG
GAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGGGCCCAA
TGAACCTCCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATTCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAG
AAGACCTTTTTGTCGGTATCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACATGAAGACATATGAAACATGTCAGCGGGTTTAAC
CCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGG
ACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCTTGTTCCGGTCCCCGTCACTGTTACGGGCGAACAAACCGCAAGG
TTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTTC
CTTTAC