Description :
From Genome Similarity Track
Location :
Scaffold_18:46056- 49254
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.9DEAD/DEAH box RNA helicase

Sequence
3198 bases(100 bases per row)
GCTCGCCCACCGCTACAAGGTATTATCTGGTGGCTGGCGCGACCATCGTGTTGGGGGTATTGGATGCTGACGGGAGTTGTAGAACGTACCATACAATACG
CTTTTGGAGGCTCTGGATGTGGCGACCGTGCGCGAGCTCGAGGACGTCCTGATCGACACCATTTACTCGGTGAGAGGGAATGAGGACGGTCAATGGATGG
GGCGATACAGAAGACTGATGGAGGGTGTGTCATGTGTGCAGGGACTCGTGCAAGGCAAGCTGGACCAGAAGTCGCGGCGCTTCGTGGTCAAGTACGCCGT
CGGACGCGACACGCACCACGAAGACATTGACAGCATGATCCAGAAGCTCACCAACTGGTTGGGTCGCTGTGGTGCATATCGGCCATGCAGCAGAAGGAAA
GCTCACCTTGATGGTGGTGGTGTGCGCAGGAAGCTCGAGTCGGCAGTCATCTGTGGAACAGTTGACCAGATCCTCGAGTACGTGTCGGCTTTTGGCGTTG
GTAGTGCGATGTCGCACCTCACGATGAAATGGACGTGCTCAGGCAAGCAGACAAGCTCGCAGACGGCGAGAAGATGCACGAGGACTCGATTCGCGCCAAG
ATGGCGGCTCGCGCCAACGAACGCAACAAGGCTGGCGGTTCGGGAGCGAGTCGCTCGCCAGAGGACTTCAGCCTGTTCCCAGACATCGCAGCTCGAAGAG
GGTACGCGTCATGCGTTAGACGCCGTCAATGTTGTCTGCGACTGACATATTTGGGGATGCTGTGTGCGTTTTGTCTAGACCGATGACGGGGAAGCAGCGT
GTGCATACCATGAACCGCAAGGGCCGGATCTGAGACCACGCCCTTCGTTCAAGACGGTGTCCGTGCGGCATCGCCGACATTTCTTTCGTACGGAAGGTCT
AAGAAGTTTTGGCGCCAGGCAAAGTTCTCTGACGCCTTGCAATGAATCCGCTTGGCTTCGTTGCCGGATCTTGATGTTGAAGCCATGTCACACACTCGAG
GTCTTCATACCCACCTTCACATCTATAGGTCACATTCACGAGTCTATAGCTTCGTTTTACAAGGCCGTCCACTGTTTTCGTGTTCGTCGTGTTCCGATTC
AAATCGCCGAAATGATGAATGGAGGCAGCGCGAAGGACCACCGGCGTCGCCACAGCCATGGCGGACCGAAGCGCGCCAAACCGCACGGTTTCCATCGCCC
CGCAGGCCATGCGACGAAGCCTCGCGATGTGCAGCCGATCCACCGCACCCCGAATGGCCAGCGCGCGCTCTCGGAGCTCGAGAAGACGCGGCGACGACTG
CCCATCTTTGGCCACCGCGCGAAGCTCGTGTCGGCGATCGCCCAGCACCAGGTTGTGATCCTCGTGGGCGAGACTGGCAGCGGCAAGACGACACAGATCC
CGCAGTACATTTACGAGAGCGACCGCGCGAACGCCCGCGTCGCGATCACGCAGCCTAGGCGAGTGGCGGCTATCACGGTTGCTCAGCGAGTGTGCGAAGA
AGTCGGACGTGGCACGCTCGGCGAGACCGTCGGGTACACGGTGCGGTTCGACGACACGACGTCCAAGAGCACGCAGCTCAAGTTCATGACGGACGGTATG
CTGGTGCGCGAGGCGCTGCTGTTCCCGGCGCTCGATCGATACTCGGTGGTGGTCCTGGACGAAGCCCACGAGCGCACGCTGCAGACGGACATTCTGTTCG
GCGTCGTCAAGCAGGCCATGCGCAAGCGGAAGGACCTCAAGGTCGTCGTCATGTCGGCGACACTGGACGTCGCGCTCTTCCGGACGTTCTTCGCCGACTT
CTCGCCCGAAGTCATCCAGATCCCCGGCCGCCAGTTCCAGGTCGACGTCTTCTACACGATGAAGACGCTCCCGGACTACTTGGACGCCGCGCTCGTGACG
GTGCTGCAGATCCACCTGGACGAGAAGGCCTCGAACGGCAGCATCCTCGTGTTCCTCACCGGCCAGGAGGACATTGAGACGCTCGAGACGCTGCTGGACG
ACTACGCGCGGTCGCTGCCTCAGGACGCGCTCAAGCTTATGCCGTGCCCGATCTTCGCCGCGATGCCGCGCGAGCAGCAGATGAGGGTGTTCGAGCCGGC
GCCGCCTGGTGTGCGTAAGGTGATCCTGGCCACCAATATCGCCGAGACGTCCATCACCATCAACGGCATCCGCTACGTGGTTGACACGGGACTAGTGAAG
CAGCGGTCGTTCGTTCCACAGACGGGAATGGAGCTGCTAAAGATCGAATCGGTCTCCAAGGCGCAAGCATGGCAGCGCACGGGTCGCGCTGGTCGGGAGG
CGCCAGGTATTTGCTTCCGGCTCTTCACCGAGGACATGTTCGACCAATTGCCGGAGCGAGCGGTGCCAGACATCCAGCGTGTCAGTCTCGAGGTCGTCGC
GCTCCAACTGAAGTGCATGGGGATCGAAGACGTGCTCGGATTTGACTTTATCGAGAAGCCCAAGCGCGACGCCATGATCCGAGCGCTGGAGAAGCTCTAC
GCTCTCGGTGCGTTGGACTCCAAGGGTGCTCTCACGACGAGAGGCAGACAGATGGCTGGTTTGCCCGTCGAACCTATGTACGCTGTCATGCTGCTCAAGG
CGACCGAGCTGGGCTGCGCGGAGGACTCGCTGAGCGTCGTGTCGATGCTGTCGGTCGAGTCGATCTTCTACTCGCCGCGCGACAAGAAGGCCGAGGCGGC
GCAATCCCGCGCGCGATTCATCGCGTACGAGGGCGACCAGATCACGCTGCTCAACATCTTCAACGCTTACATGCAGTGCAACGTCAAGCAGCGGAACAAG
TGGTGTCGGGACCACTACATCAACCACCGCGCCATGACTCGCGTCGAGAGCGTGCGCACTCAGCTCAGGACGTACCTGGAGAAGCTGGAGCTGCCGATCG
AGTCGTGCTTCCCGGACATTGATCCCGTGCGCAAGAGCATCGTGGCCGGGTTCTTTCTCAACACGGCCATGCGGTCGCTCGCTGACGGACTCGGCGGCGG
CTCCAAGACGGCGTACAAGACCATGTGCGGCAAGGCGCAGATCGTCAAGGTGCATCCGTCGTCGTCGCTGTTCCAGCGCAACCCTCCGCCAAAGTTCGTC
GTGTACAACGAGCTGGTGTTCACGAGCAACCAGTACATCCGGCAGGTGGTCATCATCGAGAAGGAGTGGCTCGTCGAGCTCGCGCCGACGTTCTTCGC