Description :
From Genome Similarity Track
Location :
Scaffold_233:4605- 5697
Sequence
1092 bases(100 bases per row)
CTTCGTTGCATCTCCAGGTCCACAGCTGCTTTTAACGCAAGTGTTTGCCACTCCCGATACCGGTTTGAATCCTTTCCTAGCGAATCCAGTTCGACGCTGG
ATCTGCCCAACGGGTAACCAGATTGCCAAACACACCAAATGATCCAGTACCAGGCGGCTCGTGCTGATGTTTGGTGATCCGGAGGTATGACTTATTACTG
AATCCACCATTCACCACCGTGATCACCCATTTTTTCCCTCTCATTACCCACAGTTCAAACCGCTTGTTGTGGGACTTGAGTGAGATCTCTGTCCATTGGC
CAGGACCGACTTCATGGAATCCCGTTGCGTAGACCGCGTCAGCCTTGCTGCTATACAGTGGCTTACGGTCGGTCATTTGGATGCGAACTTCGTCCGGCAG
ACAGAGCGTTCCGTCAGCCAGGTCCAACCTCACCCCCGCAGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCACAAA
CGGAACTTGTACACCAACTCTCCAGCCAGAGTGAGCTTGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCAGACCAACACAATCCATTGTCT
GTGTTGTATCAATTTCACAACCCACCTTACGTGCAAAGGTAGAGTCGATTATCGACACTTCGGCTCCAGTATCACAGAGTGGGACGGCACGGACATTGTT
GACCGCACCGGTCGCCTTCGACTGCTTGAACCACTTGGAGGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTTGAAGGGCCACCACA
CAAGGGCGACGCGAATAGTCACCTTCATCCGAGGTAAGAGGTCTGGCTGTATTCACCGCATTACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTCCTCT
GAACATATGCATAAATGCAGAACTTCGATCGCTCGTCACGTACCAGGCTGTTCAGGTCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGGAC
AGCAGTCCGGCATGGCGAGTCGGGTTGTACCATTGGCGAACAGCATCGAAGAAGTCGCCGATTTTACACTGACCTGCTTCGTGAACGTCTCC