Description :
From Genome Similarity Track
Location :
Scaffold_15:46047- 48164
Transcript NameFunction/comments
Physo_131241hypothetical protein

Sequence
2117 bases(100 bases per row)
TAGATCCCCCGCCTCTATTTTAGACTAGGAATTATCATGGCGATTAGCAAGCAGGCTCATGAGGTTAATCCGATTCGCAACAGATTTGTTTGTAAATACT
GAAGTTAGGCGGAACGTCGACGTGGAAGTCGACATTCCGAGCTACTTGAGCTAAATAATTATAGCTCTGTAGGTGCCGATGTAAGCCGCCAGCTTTGTAG
CGTGCAATATGGAAGGTGTCAAAGCATTCAGAGGCAGTGCACTAGATAGTCAACTCGGTCGGAGCCTTGTTGACATGGACGACTCCAAACTTCGGGCTAT
ATTAGCCCAAAGGCGTTTCGGTAGCTCTTAGCCGCCGACGCTAAATTAGACAGAATCGAGTCTCGCCAGCTTGTCCAAGCAGAATTACACACTCTTATTT
GCTGACCGATTTCGCTTTGTAGCTTGTTTTATACCCTTATGTACGGAGATTCAAATCCGATTAAGATAAATGTGTAAGCTAATAAGGCGTGGATATTCCA
ACCGCGTTTCACGATAGCATCTATTGTAAGAACCGGCTAAAACGCCCACAGTATCAACCCCTAATTATATATCAATAGCCAAATTAATCATATTATAAAT
CAGGGTTTAAATCGATTGTGATCCATATGCAGGCCTCCCTAATTGGGGGAAATGATCTCCATTTCCCCCCACCATACCCGAACAGCCTCACGAGCAGTCA
TCAGACTCGGAACAGTCGCCGACGAAGTTTGAGGCCGGACTTGGAGTTCGCTCGGCCGAGAGCTCGGTCTAACAGCTGATCAACCGCCCTATCGCAGACA
TGTTTGCGAATGGAGAGTCTGACGAGTCTTTGTTGGTACCGGTGTTTAAAAGATGGTCGTTTAATTTGTTTCGGAGGCGAATCCTTCGATGAATGTCTCG
CGACCCTCGACCGACTCCTCGCTAATTTCGAGGAATGTCGGATCAGTGTGAGCTGCACCAAGAGCATTTTCGTGCAACTCAACGTGGACTTCCTGTCCCA
CGGATTGTTCTCGTGTAATGGGCCTACTTTGACTCACTACTTTAGCTTACACGTGTGCACACGTGTGTGAGGAAGCGTAGCTTAGTTTAAACTAGAGTTA
ATTATACTCGAACCTCCGAGTATAGATTAATCTAAAAAAAGATCCAAATAATATTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGCTTTCTGA
CCTTCTCTAAATGTAATATTCTAAGTTAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCATTGCTATGCATCTCGCTCATAGGCTAAAAGATGCTGCTT
TCAGTCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGATCGTAAGTGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTT
CGAACCTCGAACAGACGTCGTGTCGGTTAGGGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACACCCCCCCCCTTCAAGGTTAGATGC
GCTGAGTCACGGCACGTCAATCAGGAAATTGACCACTCATCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCACCGAAGG
AGAAGACCGCCGTTGCAGCAGAGGGGGACAGAGACTATCTCTGTCCCCGAGTACTTCGTGCGTCATGAAGCAAAGCGTGATGCTCTTGCTGCCAAGGCTG
CGGCGGGGACAACCCAGCCGGGGATTGTCCTTGAAGGCTCTTCCGTAGTCAACGACGCCGTTGACTACGAAGACGGCGACGTGGAGATGGAGGGGGGCGA
GGCCTCTTCAAGCAAGAACAAGGAGTCTATCAACAGCGATAGTCTCGACCCGCATGCCGGGTTGAGACGCCCTCGCGAGGAAGACGACTCGGACGCTTCG
AGCTCGAAGCGTTCGCACGGCGAGAGTGAGATTCCGCTCTCTGATGCTGGGGCTTTAAGCTCCCCGCGTGATGTGGCGTCTTCGAGTTCTCCGCGCGCTG
CATTAGCAGCGCGCGATCCGTGGATGCAGTCTGCGTCAACCGCGTGGGCAACACCGTGCCTCCAAATGAAATCCCGCTGTACGTATGCAGCGTCATCCAC
GACGATGCTGTGGCGGA