Description :
From Genome Similarity Track
Location :
Scaffold_4:460362- 462714
Transcript NameFunction/comments
g3636.t1hypothetical protein

Sequence
2352 bases(100 bases per row)
CCCCACTGACCGTAAATGACACTGCGCGCCTTCTCAAACTGCACAATCTTGCGCAGTTTGTCCTTCACCGAGTCCTCAACGATGAGTTCGTCCAGCCCGC
TCGTGGGCACCACACGGTGATCGAACGTCTTCATGTGCAAGCTACCACGCATCTGCAGCGCACAGCCCGCCACAATGTCGGCTTGCGAGATAACAGGCGA
TTCACAATTCCGTGAAATGGCCTTCAGGAGGGCCGATAGGATGGCGTTCTTGATGAACCCACCACTGAGCTCGTACTTCAGAGCAATGGCGTCCCAGTCA
ATGCCAGACTCAGTCTGCAAGGCTCCGCGCATGAGGAGCACATCCCAAATCTTCCGCCGCTGGATGTGGTCAGGTGCCTTGAACTCAAACACAGCCGTAA
TACGACGGTGCATGGCCTCATCGAGGTCGAACGGTCGGTTAGTCGCAAGGAACACAATACCTTCATATCGCTCGATCTCCGTTAGCAGAGCATTGAGTAG
TCTATCGCCTCCACCATCACGCTGACGGAAAATATTCTCACACTCGTCAAAGAAAAGCACAGCGTTGCTCATGTCAGCCTCCCGGAAGAGTCCACGCAAG
TCCGCATCGGTCTCCATGCCTTCCTGACGCTTGCCCTGCAGAGACGGGAAGTCCACCAGAAGTACACGCTTTTTCAGGTGGTGTGCGACGGCGTTCACGG
TCATGGTCTTACCTGTCCCGCTAGCTCCACACAGTAACAGTACAAGGCCAGCTCCATACGCCATACCTGCCTGCTCCAGCCCGCTCTTCTTACGGTAACT
TCGGAAACTCTCGTAGCTCTCCACAGTCTCCAGAATGGTACTTTTGTGCTCCTCGGGCAGTACAACCTGGTCCAGCTGCACCTTGGGGGTGTATAAGTCC
GAGCCTTCCACCAACTCATTCATCTCGGTGTCAAGACCAACCACCCAATCCAATACACGGCGGTCCAGCTCCACACGCTGGTCGACGAGATCTCCCGCCG
TGGAGTGCCATCGGCCGCGGTGAAGCTTCACAAGACCACGAGTGAGCAGACGCGACGACTTGTAGAAGAAGACACGGTGCGCCACCTGCTCTTGGAAGGT
ATCGCAGAAGATCGACAGAATCTGGTTGATAATCACACTTTCGTCCATGCGCTGCACAGGAGACGTGTCCACTCCGTCAATCAGGTTCTTAATGACCGGA
GAGATAGTCTTGCCAATGAGCATCACAATCACATTCTGTTCAAAGCGGTTGAGTTTGAACTTAGCAGCCAGCTCTTCCAGACGTGGCAGTGGGTGACCGG
CCTGCCGTGTGAGAGACAACCTGTGCTGCGTGCGGCGGCTGTGCACGCGTTGCTTGGCCTTCAGTTCCCGTCGGCCGGCCGATGCGGGTGCCGATGACTC
CCAAGGCTGCTTCGTGCCTGCCTCCTTCATCTGATCCTTCACACGTGCACCAGACGCACGGATTGCAAACGCCACAACTTGGAAACGGTCCTCAAGGTAC
TCCAACTGGTTCTCAGGACTGTATGGCTTCAGCTCGCCAGGGTCCATAAGGGAAGACAGTAAGTAGTTCTTGTCGGTACTGGCTTCGGCAGATTTCAGCA
ACAGGTTTTTGTCGGCCTTCTCCTGGCGTTTTGTCCGTTTGCTATCACTCTTGTACTTTCCAATAAACGAGTACGCAGATGCACTAAGGTCCTCGTTCTC
TTCATGCTCCTCTGTCTCACTCTCGCTAGTGCCATGATCGTGCTCCATCGTTTCGTCTTCCTCTTCATCCTCCACCTTGTCACCACTTCGGTCGCGCTTG
CGGCCACTGACATGCGAATCCGACGTTGTCGCCGTATCCAGCACTTCACCAAAAGAGATGCCCTCGCCCTTGAGCAGTTCCTCCAACGCCGTCTGACTCA
CCTTCAACGCCTGGTTGCTCGTCAAATGCCGTCCCAGCAGCACACGCACGCAAATGTTTGACAAGCTCAGCGACGTGCAGTACGTCTCTTCGTCCACAAT
GAGCGTGCCTTCCTTCACATGCTCGCGTTCATCGTCCCTAAACTCGGCCACGTCCACTTCCGAGAGGCCCGAGAGCCTCTGGCACGTCAGGACTCTGCGC
TGCGAGTCCTCGTCCAAGATCTGGCAGCGCACGGCGTTGCTCTGACAGCCCTGCATCACGACCAGCAGTTGTAGCAGCGTCGTCTCTCCAGGCGACAGCT
TGTACATGTCGGCCAAGCGGAAGACTCTGGGCAGTCTCTTGTCGGCCTGCTTGGTGGCCGCCAGACGACACTTGGCCAGGTCATCTACATAGTTCTTGAG
TCTGGCCAGGAACGCCACGCGCTCCTCCATGTCCTGGCGGTGGGACAGCGTC